Which of the following structures are involved in balance/equilibrium? Select all that apply. cerebrum O vestibule cerebellum semicircular canals O cochlea

Q: Explain the difference between Place and Stimulus-Response learning strategies. Include the…

A: The activation of Brain sources that occur in response to auditory, visual and audiovisual stimuli…

Q: To explain: The Pasteur effect on the aerobic culture of yeast on glucose, where the rate of glucose…

A: Under anaerobic conditions, yeast uses its nutrition to produce energy. Yeast cells cannot undergo…

Q: How can you protect yourself from diseases that can be acquired from the environment?

A: 1)Good hygiene: the most important way to prevent infectionsThe first line of defense is the control…

Q: Compare the characters of lemuroidea , Tarsioidea and Arthropoidea. Pls make a chart or table so I…

A: Lemuroidea , Tarsioidea and Arthropoidea are the 3 suborders of order primates, and subclass theria…

Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…

A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…

Q: What is a TED talk? TED stands for "Technology Entertainment

A: TED is a global community, welcoming people from every discipline and culture who seek a deeper…

Q: Please discuss the value of international normalized ratio (INR) as a test. Why do you think this is…

A: PT test is the normal blood test conducted to record the time taken for blood to clot.

Q: QUESTION 12 Consanguinity most often leads to an increase in prevalence (comapred to the general…

A: autosomal recessive disorder.

Q: What are the implications of the reproductive strategies of rotifers in their survival?

A: Answer

Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…

A: Lumbar region is the lower back region including the spine,consists of five vertebrae labelled…

Q: What are the importance tof ants o other organisms and to the environment

A: The ant is one of the world's most strongest animals comparable to its size. A single ant can carry…

Q: Not all Americans are willing to get the covid-19 vaccine, and not all countries have enough…

A: Vaccination : A biological preparation that can be used to activate the immune response in the body…

Q: I. lipase II. hydrochloric acid III. pepsinogen A. I only В. I only C. I and II only D. II and III…

A: Gastric juice is secreted by the stomach wall when stimulated by the hormone gastrin. When initially…

Q: Describe how ecology affects evolution. Provide an example in which the ecological interaction…

A: Ecology is the inter relationship between the biotic community and abiotic environment.  Because it…

Q: 14. An antibody can be best described as a A.white blood cells that engulfs an invading microbe B.…

A: Antibody - A protein made by plasma cells (a type of white blood cell) in response to an antigen (a…

Q: What is the frequency of alleles in this population? a) CB (p)= 0.2 CG (q)= 0.8 b) CB (p)= 0.3 CG…

A: In the question, a picture is given that is the representation of a population where the green…

Q: How could you prove that the Tn5 insertion was in the lac operon?

A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…

Q: To explain: How the loss of AP3 causes a defect in melanosomes.

A: Pigment is a material that changes the colour of transmitted light due to selective wavelength…

Q: What is the advantage, if any, of direct development in gnathostomulids? 2. What are the…

A: Gnathostomulids is the marine worm while rotifers are multicellular organism.

Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…

A: The polar bear is a hyper-carnivorous bear whose native range lies within the Arctic Circle,…

Q: The joining of male and female reproductive cells is called?? II. It is the make reproductive part…

A: Plants' life cycles comprise two stages called alternation of generations. The haploid gametophyte…

Q: What would happen if you forgot to add NaCl in culture used for isolating vibrios? Which  species…

A: Vibrio bacteria are comma shaped(Curved rod shaped)bacteria; which shows mobility  because of the…

Q: It  has  been  established  that  V.  parahaemolyticus  cross-reacts  with  many  marine  bacteria…

A: Serological tests signify those tests, that detect the antibodies against a microorganism. It…

Q: I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A…

A: Forensic analysis using DNA samples  The DNA sequences can be a helpful tool to determine the…

Q: what is structural gene and what is non-structural gene? what is the differences between them?

A: Introduction Genetics is the branch of science that deals with genetic material like genome, genes,…

Q: explain why the invention of solid culture media was of great importance to the development of…

A: Most microbiological tests rely on culture media to obtain pure cultures, grow and count microbes,…

Q: To examine: Whether the statement "most intracellular signaling pathways provide numerous…

A: The intracellular signalling network is made up of several signalling pathways that carry…

Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…

A:

Q: vascular cylinder, vascular bundle, ground tissue, epidermis , palisade mesophyll, spongy mesophyll,…

A:

Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…

A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…

Q: A protein wilth a domain inside the hydrophobic plasma membrane and a hydrophilic domain inside of…

A: Introduction Membrane proteins:- These are common proteins that are part of, or interact with,…

Q: Calcitonin is enzyme that functions to reduce blood calcium levels

A: Calcium may be a mineral that's found in a very form of foods. calcium is needed by the body to take…

Q: what are 4 antagonistic interaction between two or more species that are exploited to improve…

A: Antagonist interaction between two species is the negative interaction where one species is…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…

A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…

Q: All of the following are generated directly during the Krebs (TCA) cycle except? a. ATP b. GTP c.…

A:

Q: ONE OF THE ANSWER IS WRONG PLEASE HELP ME FIND THE RIGHT ANSWER Duplication of genes is an…

A: Dominant alleles are always expressed whether present in homozygous or heterozygous forms. Where as…

Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this? 

A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…

Q: Gamma globulins is synthesized in the liver True false plasma lipid is synthesis in the Kidney liver…

A: Please follow steps 2, 3 & 4 for detailed explanation.

Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…

A: Aorta is the largest artery that carries oxygenated blood to rest of the heart.

Q: To examine: Whether the statement, "The three respiratory enzyme complexes in the mitochondrial…

A: The inner mitochondrial membrane contains three respiratory enzyme complexes that electrons pass…

Q: P. D, and Q are three genes found on a single chromosome in greyhounds. The recombination…

A: The genetic map is defined as the arrangements of genes according to the recombination frequencies…

Q: Each of the animal cells shown below is ina different stage of mitosis. Select the cell that is…

A: Mitosis is the process in which the sister chromatids separate from each other and move to opposite…

Q: Calcium deficiency disease can lead to a health problem, where the level of calcium in the blood was…

A: The calcium level in the blood is excessively low in hypocalcemia. A low calcium level can be caused…

Q: O Ferquency O haematuria O oliguria

A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…

Q: how will the body maintain homeostasis in osmoregulation

A: Homeostasis refers to an animal's capacity to manage different physiological cycles to keep the…

Q: 1. Which of the ff is NOT a form of asexual reproduction? A. Budding B. Fission C. Fragmentation D.…

A: Introduction :- In biology, budding is a type of asexual reproduction in which a new individual…

Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…

A: Heart  Heart is a pumping organ of the body that pump blood to whole part of the body.

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: RNA polymerase is an enzyme that synthesis the RNA by following a strand of DNA. It is responsible…

Q: Give an example of a physiological adaptation using organs and/or tissues of an organism of your…

A: A metabolic or physiologic adjustment within an organism's cell or tissues in response to an…

Communication

Communication is a method of transferring information between two persons or organisms. Communication is possible using mutually understood behaviors such as signs, symbols, or language. In the year 1980, S. F. Scudder proposed communication theory. According to his ideas, all living beings on the earth communicate, but the methods of communication differ. Communication skills are now part of soft skills.