Q: Define the term dense plaques?
A: Plaque can be defined as the root cause of many oral health issues. The bacteria in plaque will…
Q: if an incision is found on the inner face of the ilium, wht cvan be determined about the type and…
A: As per the case , an incision has been found on the inner face of the ilium. The uppermost and…
Q: Explain why croup is primarily a disease of children.
A: Croup is a primary common respiratory viral infection also known as laryngotracheobronchitis or…
Q: Briefly tell What gives rise to the symptoms?
A: Nursing counselling and advise involves certain intervention which helps process focusing on the…
Q: How is dental plaque associated with periodontal disease?
A: its a biofilm, yellow in color, deposited on teeth.
Q: Define diffuse interstitial fibrosis?
A: Respiration is the process by which oxygen is taken up from the atmosphere and carbon dioxide is…
Q: Define agglutinogen?
A: We know that Agglutinogen can cause the agglutination of cells that contain the antigen or particles…
Q: Explain The local inflammatory events occurring in response to a wound?
A: Answer- Inflammation is the process which is a part of immune response at the site of infection to…
Q: Explain the role of CTD
A: CTD is the carboxy terminal domain also called as c-terminal domain of the RNA polymerase II is the…
Q: Compare the physical manifestations of Buerger disease and Raynaud phenomenon.
A: The main cause of Buerger disease is the narrowing of the veins and arteries that supply the arms…
Q: What is computed tomography (CT)?
A: Anatomy and physiology are the branches of biology, anatomy deals with the study of the structure of…
Q: What gives rise to the symptoms?
A: The disease is a harmful deviation from normal functioning. Diseases are associated with certain…
Q: Describe two spontaneous lesions that can lead tomutations.
A: Mutation can be defined as the phenomenon in which there is a change of the sequence of the genome…
Q: describe depurination
A: Nitrogenous bases are organic compounds that form the nucleotides of the nucleic acids. These…
Q: Give reason for success of mendal?
A: Genetics is the branch of biology that deals with the study of genome of an organism and its gene…
Q: Explain why healing could be delayed in individuals takingglucocorticoids over a long period of…
A: Glucocorticoids are a type of steroid hormone that belongs to the corticosteroids family.…
Q: Define agglutinin
A: Immunoglobulins (Ig) are also designated as antibodies (Ag) and helps in killing the pathogenic…
Q: What errors can occur during mieosis?
A: As we know all living organisms are made of basic unit of structure and function called as cell.…
Q: State the function of leydig's cells.
A: Reproductive system or genital system is used for the sexual reproduction. Testes are a part of male…
Q: e most likely diagnosis?
A: Patient is suffering from granulomatosis with polyangittis formerly known as wegener's…
Q: Distinguish between tinea pedis and tinea capitis bylocation and lesion.
A: Tinea pedis:- also called as “Athlete's foot” It is a fungal skin infection that occurs between the…
Q: 5: Name the large scar indicated by the pointer.
A: Seed is an embryonic part of the plant that remain enclosed in a protective covering.
Q: Why is the CMS so important to the healthcare organizations?
A: Medicare: a. It is a health insurance program for people who are above 65 years of age and are…
Q: Describe the term astrocyte.
A: Glial cells are non-neuronal cells that can be found in both the central and peripheral nervous…
Q: What is leishmania?
A: The disease is a condition or illness or sickness of the living animal or plant body or of one of…
Q: Explain the Xinactivation center (Xic) ?
A: X Chromosome: Humans generally have one pair of Sex chromosomes, XX for females and XY for males in…
Q: 2]. Please make table to differentiate ITP, TTP, HIT, DIC.
A: These diseases affect platelets in different ways. Although their symptoms may be similar, the…
Q: Describe the phagocytic function of mesangial cells.
A: Mesangial cells are specialty cells in the renal components of the glomerulus mesangium. They…
Q: state five conditione necessara for geminakon
A: The development of a seedling from seed is referred to as germination. Germination occurs when there…
Q: 8. Name the tissue within red double arrow 9a. Name the tissue indicated by the black arrow 9b. Name…
A: Tissue is defined as the group of cells which have similar structure and they function together as a…
Q: What is Usher's Syndrome?
A: Usher's Syndrome is genetic condition. It was named for Charles Usher, a eye doctor who identified…
Q: How is shock managed?
A:
Q: which statements are False?
A: The Answers are provided below.
Q: What do Agranulocytes include?
A: A formed element of the blood that is involved in protecting the body against any kind of infection…
Q: Explain the “great plate count anomaly.”
A: Microbiological culture is a method of multiplying microorganisms in lab conditions on growth media.…
Q: Define malignant
A: Biology terms are fundamental concepts and terms used in biology, which is the study of life and…
Q: define stroma
A: Plants are autotrophic, living organism composed of multicellular, eukaryotic cells with…
Q: How do malign neoplasiasappear?
A: Neoplasms are mass of tissues that form when cells divide excessively and persist longer. They can…
Q: Outline the purpose of a colostomy
A: Colostomy It is a surgical opening or artificially created opening in the large intestine. It may be…
Q: Define the term Cor pulmonale?
A: Biology terms are fundamental concepts and terms used in biology, which is the study of life and…
Q: Explain why cellular components of all resected skinlesions should be evaluated by a pathologist.
A: A lesion is an area of abnormal growth or appearance found anywhere on or in the body. It may be…
Step by step
Solved in 2 steps
- These questions relates to DNA extraction, the choices are in the attached photos (i) Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: (ii)Which of the following gels is the preferred choice for separation of DNA fragments?QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.QUESTION 27 Which of the following methods can be used to compare the amounts of one specific mRNA that is expressed by two different cell lines? A. Immunohistochemistry B. Western blotting C. Polymerase chain reaction (PCR) D. Immunocytochemistry
- Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with proteinQuestion:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGWith regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…
- Question: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what and how viral vector is used AND/OR CRISPR-Cas is used? d) what is in the horizen re. development of new virus-based gene delivery vesicle?Question 36 Which of these is not considered a method of DNA extraction? organic filtration differential purification all of the above are extraction methodsquestion: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Biomimetic Engineering of Nanodelivery Systems: Artificial Viruses in the Making In an effort to engineer the next generation of nanoscale vectors, scientists have moved from using inorganic components aimed at obtaining inert structures to utilizing biological building blocks that are able to convey additional functionalities to the resulting construct. To cope with the complexity of the body and to evade the multiple layers of defense that tissues and organs have, it is critical to rely on the ability of certain materials to interact with, rather than to eschew, the biology of our body. Every NP system conceived to date faces one common fate: whether injected,…
- Question 12 Imagine you are a cytogeneticist preparing a karyotype, but you forgot to add the colchicine in the early part of the protocol. You are not aware of the mistake, until you look at the slides, as you are getting ready to photograph the slides of the cells that have been dropped, fixed, and stained. What would you see on the slides, that would tell you that you made a mistake earlier in the karyotype protocol?QUESTION:- Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are many instances when microarrays or limited sequencing of a selected panel of genes are the approaches chosen for clinical use , Why?QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…