QUESTION 21 A race condition OA) results when several threads try to access the same data concurrently OB) results when several threads try to access and modify the same data concurrently OC) will result only if the outcome of execution does not depend on the order in which instructions are executed OD) none of the above QUESTION 22 A counting semaphore OA) is essentially an integer variable OB) is accessed through only one standard operation OC) can be modified simultaneously by multiple threads OD) cannot be used to control access to a thread's critical sections Click Save and Submit to save and submit. Click Save All Answers to save all answers.

QUESTION 21 A race condition OA) results when several threads try to access the same data concurrently OB) results when several threads try to access and modify the same data concurrently OC) will result only if the outcome of execution does not depend on the order in which instructions are executed OD) none of the above QUESTION 22 A counting semaphore OA) is essentially an integer variable OB) is accessed through only one standard operation OC) can be modified simultaneously by multiple threads OD) cannot be used to control access to a thread's critical sections Click Save and Submit to save and submit. Click Save All Answers to save all answers.

Systems Architecture

7th Edition

ISBN:9781305080195

Author:Stephen D. Burd

Publisher:Stephen D. Burd

Chapter11: Operating Systems

Section: Chapter Questions

Problem 3VE

See similar textbooks

Similar questions

true or false a. All of the instructions in a System function call in a user-program are executed in kernel-mode. b. A process immediately upon creation at t=0 creates 10 threads; each of the threads intends to sleep for 2sec and then execute code for 4sec. In the mean-time the process terminates after the thread creation task that lasts 1sec. It is possible that the wall-clock (outside clock) time of the execution of a thread will be more than 40sec. c. The PCB of a process is stored in an individual process's memory in user-space.
Explain the concept of thread synchronization and discuss three synchronization mechanisms used to coordinate threads in a multithreaded environment.
PLEASE ANSWER ACCORDING TO THE INSTRUCTIONS POSIX Threads (Data Decomposition Problem) COMP 350 For this programming assignment the use of the pthread library will be required. The problem is to read in a matrix from a given text file, use n threads to sum each row of the matrix. Your program will then find the row or rows with the maximum value. The maximum value and row number will be written to a file called output.txt. The program will receive input from the command line. For example: INPUT: [student@euler pgm] ./a.out 4 input.txt From the command line the number threads to create and the file to be read will be determined by the user. The input file will have this format: 6 1 2 3 4 5 6 2 2 2 2 2 2 3 3 3 3 3 3 1 1 1 1 1 1 0 0 0 0 0 0 10 9 8 7 6 OUTPUT: Output will be written to a file named output.txt . The format for your output should be: Maximum Row(s) and value: Row 5 40 The program name will be matrix.cpp and placed in your pgm directory.
Fill in the blanks:5. The ( 6 ) is used to implement mutual exclusion where it can be decremented by aprocess and incremented by another, but the value must either be 0 or 1.6. If deadlock prevention approach is used to deal with deadlocks in a system, the ( 7 )condition can be prevented using the direct method.7. Two threads may share the memory space, but they cannot share the same ( 8 )8. Consider round-robin (RR) scheduling algorithm is implemented with 2 seconds timeslice and it is now selecting a new process; if we have 3 blocked processes (A, B, and C),and A has been waiting the longest, then A would need to wait a period of ( 9 ) secondsto be selected.9. In real-time systems, if a task appears at random times, then it is considered ( 10 ).
YES or NO: The process can have several user-level threads with varying priority. Each modification must be applied independently.
Describe the techniques for handling concurrent access issues when multiple processes or threads attempt to read or write to the same file simultaneously.
A deadlock condition can occur in concurrent code if two or more threads each hold a resource and are waiting for another thread to release a resource they need to proceed. Question 10 options: True False
Which of the following is true? Select one: In general, creation time of a process is faster than creation time of a thread within a program In general, communication between two independent processes is faster than communication between two threads Parent and child processes share same instruction counter Threads of a process can share data via global variables In a multithreaded process each thread shares the instruction counter of the process
If you can please add some comments to the code to help me understand thank you Please write a c++ program that will take in a file, a number_of_bytes and number_of_threads. So it will take in 3 arguments in the command line. mmap the number_of_bytes of the given file into memory. The program will mmap 100 Megabyte of file into memory and use 4 threads to examine the bytes. The main will not participate in the computation, but will create the specified number of threads, and wait for them to complete the computation, and the main will then print the answer. At most 8 threads will be specified to be created. Each file will contain a long string of letters like DNA, i.e. a,c,g,t The program should determine how many 20-character substrings contain more than 11 a's. For example, in this string there are characters matches: tattataaagtagaaatataactgaaggttcagccgctggattataaagtagaaatataaaaagtagaaatataactgaa The program should output: total matches number # number is replaced by the correct…
Describe the use of thread synchronization mechanisms such as mutexes, semaphores, and condition variables in managing threads.
In C++, not C please! Assume that your computer has 4 CPUs. Write a multithreaded program that runs 4 different threads concurrently. The entire process will add the first 1,000,000 numbers (from 1 to 1,000,000) to a shared variable sum. You need to use a pthread_mutex_t to provide mutual exclusion so that the final result of sum is 500,000,500,000 Note: you can download and modify the file summation_thread_shared_sum.cpp. This file does not use a mutex lock, so the result is incorrect. You must add a mutex lock correctly in the file so that the program generates the right outcome.
Would you agree that suspended processes will always hold a zero (0) value for both read and write I/O operations? Is the number of threads directly proportional to the number of bytes written by the process in I/O operation?