QUESTION 22 During the search for the Cystic Fibrosis (CF) gene the investigators used various criteria to conclude that they had arrived at a segment that represented a gene. Which of the properties below was among the criteria used by the investigators? O A. the presence of sequence palindromes O B. gene-specific restriction maps O C. interspecies sequence conservation O D. polyadenylation signals O E. the presence of AT-rich islands
Q: 22. During oxygenic photosynthesis, the oxygen atoms that start out in substrate water molecules…
A: Molecular oxygen is produced as a byproduct of oxygenic photosynthesis, which is a non-cyclic…
Q: Which factor have the greatest impact on the rate of reaction. Choose from…
A: Breakdown of glucose (C6H12O6) molecule in the presence of oxygen is called as aerobic respiration.…
Q: Metalloprotein linkages are most likely to be formed between: Select one: O a. A leucine and a…
A: Correct option would be b) two cysteines. Metals bind to electronegative ligands like nitrogen,…
Q: Distinguish DNA and RNA according to their structure and functions.
A: DNA & RNA are the nucleic acid found in living organism. DNA: Deoxyribonucleic acid RNA:…
Q: Differentiate water-soluble and fat-soluble vitamins?
A: Vitamins are necessary for various body functions, including vision, immunity, reproductive health,…
Q: What are the benefits and risks of taking supplements?
A: Supplements are generally of three type dietary supplements, bodybuilding supplements and herbal…
Q: Compare and contrast the following items related to lipid metabolism. Cite their main…
A: 1)Dehydrogenase enzyme vs. dehydratase enzyme.- Dehydrogenase Enzyme- 1)Pyruvate dehydrogenase is a…
Q: 1.Rubisco, which catalyzes the fixation of carbon dioxide during photosynthesis in plants and many…
A: Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is the predominant protein in…
Q: 11. How can you relate waterfalls to a mole of glucose? 12 What are the stens in catabolism?
A: Potential energy- Energy in stored form Kinetic energy- Energy when it gets released
Q: 7. Complete the table below. Catabolic Function Disorder/Disease due to hormone abnormal activity
A: Catabolism is a group of metabolic pathways that break down molecules into smaller units, which are…
Q: 2. In the sports camp, a group of students have been intensively swimming in a pool for 60 minutes…
A: The meal consist of carbohydrate, proteins and fats. The digestion of carbohydrates starts from the…
Q: Amylose is comprised of glucose monomers connected by what kind of glycosidic bond? a (1 -->4) a (1…
A: Introduction: Polysaccharides are polymeric carbohydrate structures, formed of repeating units that…
Q: How is coral like cities? Why are they important?
A: Corals are invertebrates that belong to the Cnidaria family of colourful as well as fascinating…
Q: One indication of the relative importance of various ATP-producing pathways is the Vmax of certain…
A: The production of ATP can occur by a number of distinct cellular processes. There are majorly three…
Q: 26. AN ORGANIC COFACTOR IN A CONJUGATED ENZYME? A. NEITHER VITAMINS NOR MINERALS B. MINERALS C.…
A: Hi. Thank you for the question, as per the honor code, we are allowed to answer three sub-parts at a…
Q: which of the following is not correct about peptide bonding? A- It occupies a single plane B- It…
A: Peptides are composed of twenty standard amino acids. These twenty standard amino acids differ from…
Q: 10. It was found that At coordinates to a metal in a 4:1 stoichiometry. Noting that A has a ba…
A: Biological important of coordination compounds like the heme group, which is Fe-Porphyrin complex…
Q: Add linking words to describe the connections between your word cards. Your connections should o be…
A: The carbohydrates are the polyhydroxy aldehydes or ketones or the compounds that produce them on…
Q: 4. Which among the given peptides will form hydrogen bond with another similar peptide chain? i.…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: TITLE : INTRODUCTION TO BASIC BIOCHEMISTRY LABORATORY TECHNIQUES Objectives: Introducing to the…
A: In a solution concentration of solute is reduced simply by mixing more water or by adding…
Q: During carbon dioxide transport, a typical Bohr effect takes place at the _________ when ________…
A: Bohr effect - The effect of pH and CO2 concentration on the binding and release of oxygen by…
Q: The conversion of fumarate to oxaloacetate in the citric acid cycle yields one NADH. If the fumarate…
A: TCA cycle is both catabolic and anabolic therefore, it is called amphibolic. All other cycles…
Q: 2. For an exergonic reaction, what is the value of AG?
A: The ∆G of exergonic reactions is a negative value, the change in Gibbs energy result is negative.
Q: 56. ONE OF THE FOLLOWING IS NOT A GENERAL STAGE IN THE BIOCHEMICAL ENERGY PRODUCTION? A. CITRIC…
A: The carbohydrates, and lipids present in the food being consumed act as the source of energy. It can…
Q: The following figure depicts the breakdown of purine nucleotides, which are the nucleotides with…
A: Introduction: Uric acid is the end product of purine metabolism and is excreted by the kidneys. Gout…
Q: Which carbons of Glucose 1-Phosphate will be incorporated into Lauric acid (C-12) by the Fatty Acid…
A: Correct option is option G: All carbons will be incorporated. Glucose (6C) in the form of…
Q: Oncofetal antigen or carcinoembryonic antigen are examples of ----. Tumor specific antigens. Tumor…
A: The T cell immunotherapies target two major types of tumour antigens: private antigens and public…
Q: Describe in no more than 10 sentences the four levels of protein in structure and cite the…
A: Proteins are organic molecules composed of amino acids. The four levels of protein structure…
Q: The receptor-associated proteins called G proteins... A. bind GTP. B. can activate or inhibit an…
A: G-proteins are associated with G-protein coupled receptors (GPCRs). GPCR is a seven transmembrane…
Q: Which of these are NOT considered as a post-transcriptional modiification? choices: a. poly-C…
A: PTMs (post-transcriptional modifications) are procedures that help to produce mature, functional…
Q: 3. What are the enzymes involved in an irreversible reaction? How are these enzymes being activated?…
A: Enzymes are biological catalysts that are proteins. Chemical reactions are sped up by catalysts.…
Q: Discusskey impairments that are characteristic in the altered glucose metabolism of people with Type…
A: This is a condition where the body produces insulin , but the insulin response system is crippled.…
Q: The enzyme lactate dehydrogenase (LDH) is produced as an isozyme, which is a way to control the…
A: Lactate dehydrogenase (LDH) is an enzyme of the anaerobic metabolic pathway and is an oxidoreductase…
Q: Why does complement only rarely kill host cells?
A: There are three complement system activation pathways: classical, alternative, lectin main steps…
Q: After purifying alkaline phosphatase, you perform enzyme kinetic experiments with and without an…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Hydroxylation of proline and lysine residues in collagen structure, leads to creating more bonds, so…
A: Collagen protein that is made of three polypeptide chains has an important structural role. The…
Q: The first step in glycolysis can be catalyzed by both hexokinase and glucokinase. Describe two…
A: Glucose molecules are metabolized through the glycolytic pathway to release energy in the form of…
Q: किठoहेण्रोक ो8 मलेटन्य मेठ वड़ Smpie बकd शfo usta ४ eb0 Tयंल (०) ট) om)०ठकब्ब वकव हानकवारड १००१ ern)…
A: For humans, oxygen is an essential gas. It is essential for aerobic respiration, which generates…
Q: commercial value associatiatef with glutamate Dehydrogenase? Propose your own ideas!
A: Glutamate dehydrogenase (GDH) is a hexameric enzyme that is it has six subunits and catalyzes the…
Q: Statement I: Glucose, galactose & fructose are absorbed in the stomach Statement II: Galactose and…
A: Metabolism is the set of chemical reactions in organisms that includes anabolism and catabolism.
Q: Epidemiological studies demonstrated that comprehensive lifestyle changes;
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Construct an explanation for each step of DNA Isolation.
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: What is the hydrolyzed component of the structure below
A: Phosphatidylserine is a phospholipid and is an intrinsic component of the cell membrane.
Q: HO H. H. H. Но ÓH OH H H. H Но OH 1,1 О 1,2 1,3 1,4 1,5 1,6
A: Photosynthesis produces carbohydrates in plants. Animals rely on natural carbohydrate supplies such…
Q: Read each pair of sentences and then choose the letter of the correct answer. Your answer must be in…
A: The electron transport chain transports electrons through a series of electron carriers. The…
Q: Due to a nucleotide substitution, the fourth residue of H3 in a specific tissue cell of an organism…
A: Protein domains are the structural units of protein that are responsible for specific function of…
Q: This module introduced electrolytes (a substance that conducts electricity when dissolved in water).…
A: One electrolyte which is essential for maintaining the fluid balance of the body is calcium. If…
Q: 1 Unoccupied receptor does not interact with G, protein. Extra- collular space -Hormone or neuro-…
A:
Q: If there are three genes and you want to determine the distance between these genes, what are you…
A: Recombination frequency is used as a quantitative measure of the distance between two genes in a…
Q: Draw tyrosine metabolic pathway from glycolysis and Krebs cycle. Mark every carbon.
A: Glycolysis is metabolic pathway in which glucose (6 carbon molecule) breakdown into 3 carbon…
Step by step
Solved in 3 steps
- QUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…QUESTION NO. 1 Antisense nucleic acids A. complementary to mRNA would enhance translation . B. could result if a gene is inserted downstream of a promoter but in opposite direction to normal. C. can have no clinical uses. D. react only with DNA. E. are necessary for recombinant DNA technology. QUESTION NO. 2 There is a window in which the effect is primarily on viral replication since AZT is much less effective at competing with dTTP for incorporation by cellular DNA polymerases because of the proofreading ability of DNA polymerases. Proofreading activity co maintain the fidelity of DNA synthesis A. occurs after the synthesis has been completed. B. is a function of 3' co 5' exonuclease activity intrinsic to or associated with DNA polymerases. C. requires the presence of an enzyme separate from the DNA polymerases. D. removes mismatched bases in the interior of the chain. E. does nor occur in prokaryotes.
- QUESTION NO. 1 Antisense nucleic acids A. complementary to mRNA would enhance translation . B. could result if a gene is inserted downstream of a promoter but in opposite direction to normal. C. can have no clinical uses. D. react only with DNA. E. are necessary for recombinant DNA technology.QUESTION NO. 2 There is a window in which the effect is primarily on viral replication since AZT is much less effective at competing with dTTP for incorporation by cellular DNA polymerases because of the proofreading ability of DNA polymerases. Proofreading activity co maintain the fidelity of DNA synthesis A. occurs after the synthesis has been completed. B. is a function of 3' co 5' exonuclease activity intrinsic to or associated with DNA polymerases. C. requires the presence of an enzyme separate from the DNA polymerases. D. removes mismatched bases in the interior of the chain. E. does nor occur in prokaryotes. QUESTION NO. 3…QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.Question: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what and how viral vector is used AND/OR CRISPR-Cas is used? d) what is in the horizen re. development of new virus-based gene delivery vesicle?
- QUESTION 2 2.1 Recombinant plasmids are often used to produce therapeutic proteins. Elaborate on the steps you would follow to generate a recombinant plasmid that can be used in future toexpress a therapeutic protein of your choice. In your answer, include the important reagents used and their functions. 2.2 Thoroughly explain at least three different techniques you would use to confirm successful recombination in 2.1. In your answer, outline the principle behind each technique. 2.3 With supporting points, outline the Polymerase chain reaction (PCR) technique you would choose to amplify a desired gene from a Retrovirus.QUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very sensitive to light and are highly susceptible to skin cancers. The study of such patients has enhanced our knowledge of DNA repair because XP is caused by defective DNA repair nucleotide excision repair. (A variant, XP-V, is deficient in postreplication repair.) In nucleotide excision repair A. removal of the damaged bases occurs on only one strand of the DNA. B. only thymine dimers generated by UV light can be removed . C. the excision nuclease is an exonuclease. D. a single multifunctional enzyme carries out the repair process. E. only the damaged nucleotides are removed. QUESTION NO.2 Homologous recombination: A. occurs only between two segments from the same DNA molecule. B. requires that a specific DNA sequence be present. C. requires one of the duplexes undergoing recombination be nicked in both strands. D. involves a…QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…
- QUESTION 27 Which of the following methods can be used to compare the amounts of one specific mRNA that is expressed by two different cell lines? A. Immunohistochemistry B. Western blotting C. Polymerase chain reaction (PCR) D. ImmunocytochemistryQUESTION 11.1 Give an overview of the possible applications of microbial biotechnology that can be used to curb the spread of newly emerging diseases such as Covid-19. 1.2 Although recombinant DNA technology has proven beneficial in health, agriculture and the environment, its public perception has always been an issue. In your OWN views, discussthe possible social and ethical implications that could make the public hesitant to accept some products of recombinant DNA technologyQUESTION 25 What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA sequences B. Minisatellites C. Exons of genes encoding proteins D. Introns of genes encoding proteins