Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the mRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar).

Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the mRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar).

Biochemistry

9th Edition

ISBN:9781305961135

Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Chapter3: Amino Acids And Peptides

Section: Chapter Questions

Problem 54RE: THOUGHT QUESTION Imagine we identify a gene that is directly responsible for the effects of...

See similar textbooks

Similar questions

Question: A decapeptide composed of ser, ala, IIe. his, trp, phe was treated with 1-flouro- 2,4-dinitrobenzene. It gave a DNP-his on the N terminal and free trp when treated with carboxypeptidase. Upon partial hydrolysis of the peptide, the following fragments were obtained. a. his-lle-phe-ala c. his-ala-phe e. ser-lle-his b. ala-phe-trp d. phe-ala-ser Give the amino acid sequence of the above decapeptide.
Text:QUESTION 16 Protein maturation in the ER includes. A Disulfide bond formation B. proteolytic cleavage C attachment of oligosaccharide d. Prolyl isomertzation
QUESTION NO. 1Targeting a protein to be degraded within proteasomes usually requires ubiquitin. In the function of ubiquitin all of the following are true except: A. ATP is required for activation of ubiquicin. B. a peptide bond forms between the carboxyl terminal of ubiquitin and an ε-amino group of a lysine . C. linkage of a protein to ubiquitin does not always mark it for degradation. D. the N-terminal amino acid is one determinant of selection for degradation. E. ATP is required by the enzyme that transfers the ubiquitin to the protein to be degraded QUESTION NO. 2Much of procollagen formation occurs in the endoplasmic reticulum and Golgi apparatus which requires signal peptide. All of the following statements about targeting a protein for the ER are true except. A. signal peptide usually has a positively charged N-terminus and a stretch of hydrophobic amino acids. B. signal peptide emerging from a free ribosome binds signal recognition…
GABA (B) Need help answering these questions about the GABA(B) protein.  What class (globular, fibrous, membrane) protein is the protein Identify the organism (or organisms that have this protein) Identify the cellular location of this protein Describe the function Find the primary structure (list it on a slide) Describe secondary structure (alpha-helix, beta sheet, and how many of each and what percent of the total protein) Find a picture of the tertiary structure (which should also show secondary structure) Does the protein have a quaternary structure, if so what is it?
Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
Question:- What is the best description of tRNA (transfer RNA)? Question 15 options: It temporarily stores genetic information. It is an adaptor molecule that translates nucleotide information to polypeptide information. It is the RNA machinery for peptide bond formations. It encodes protein information.
Question: Which base (A, C, T or G) corresponds to X in the unknown? I did the experiment, got the data below, and calculated the binding constants. But I am TOTALLY lost as to how to figure this out! I don't even know what steps I would take. Base pairs Data – all had Temp = 250C PH = 7 Binding Constant A & X [A] = 0.00373221M [X] = 0.00373221M [AX] = 0.0462678M 3.322 C & X [C] = 0.0469007M [X] = 0.0469007M [CX] = 0.00309935M 1.409 T & X [T] = 0.0452279M [X] = 0.0452279M [TX] = 0.00477212M 2.333 G & X [G] = 0.0469554M [X] = 0.0469554M [GX] = 0.00304456M 2.633
Question: Hi, can someone help me with this question thanks in advance. Select one of the following genetic diseases that appear in the following list:galactosemiacystic fibrosisDown's Syndromefamilial hypercholesterolemiamuscle gystrophyHuntington's diseasesickle cell anemiahemophiliaTay-Sachs diseasedescribe a composition about how the selected condition is generated. Include details about the number of people who report the disease, symptoms, treatments, among other aspects that you consider important. thanks
QUESTION 13 Match the primary sequence to its characteristics/function/fate N-signal signal-anchor stop-anchor nuclear localization sequence KDEL 1. found at carboxyl terminus of ER resident proteins, interaction with its receptor directs retrieval from Golgi 2. hydrophobic, interacts with SRP and translocon, becomes transmembrane helix 3. mostly hydrophobic, interacts with SRP, cut off 4. hydrophobic, interacts with translocon, becomes transmembrane helix 5. basic, interacts with importin-alpha
Question for protein crystallography- 1. While performing a routine protein crystallization screening, you observe that one of your well drops has doubled in size compared to the remaining wells. Note: the drop in question was set up by taking 1 µL of the protein solution (10 mg/mL LDH in 20 mM TRIS pH 7.5, 0.5 M NaCl and 10% PEG 4000K) and adding it to 1 µL of the crystallization solution (10% PEG 4000K, 50 mM NaCl and 20 mM TRIS pH 8.0). Why did this drop grow larger in size compared to when you initially set it up?
QUESTION 6 What is the three ketter code for each peptide(a) KFYV(b) ERSC(c) PIMFThe 3-letter code for Peptide (a) is: The 3-letter code for Peptide (b) is: The 3-letter code for Peptide (c) is:
THOUGHT QUESTION Imagine we identify a gene that is directly responsible for the effects of vasopressin on male mammals, including humans-we will call it trust1-that leads to the production of a vasopressin receptor in the brain, which we will call TRUST1. There are different versions of trust1, all of which lead to different levels of the behavior associated with this neuropeptide on male behavior. Give some examples where it would be a good idea to know a particular males genotype-that is, which of the trust1 genes he has. Give an example of when you think science has gone too far and this information should not be known.