Questions and situational problems I. A particular gene codes for a mature mRNA containing 900 bases, which is translated into a 40 kDa protein. A mutant form of the gene created by a single point mutation yiclds an 830-base mature mRNA yielding a 37 kDa protein with modified enzymatic activity. The analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.
Q: In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during…
A: * Translation is the process in which genetic code is present in a messenger RNA molecule is decoded…
Q: QUESTION distone modifying enzymes can be over- or under-expressed in a variety of human diseases…
A: “Since you’ve asked multiple questions, we are solving the first question (Question 6) for you.”…
Q: Question Amude ol and a san cel both cartan the same 46 chromosomes, but express d fferent genes, In…
A: Transcription factors are proteins that help in turn specific genes "on" or "off" by binding to…
Q: 24. TRUE or FALSE: A microRNA (in red) binds to its mRNA target (black) as shown below:…
A: False The target will be cleaved.
Q: Question 8. How is the green fluorescent protein (GFP) attached to the protein for which it serves…
A: The GEP can be described as a protein kind that can be naturally found in some living organisms such…
Q: Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on…
A: Mutations are changes that occur in the genetic sequence of an organism. These changes alter the…
Q: why chromotography isn't a good fit to detemine mitochondrial RNA polymerase
A: Chromatography is a technique that is based on the principle of partition of different molecules…
Q: Give the disadvantages of using cisplatin as an anti-cancer drug and give examples of how newer…
A: disadvantages of using cisplatin as an anti-cancer drug: Cisplatin is a chemotherapy drug used to…
Q: A gene can best be described as a segment of DNA that A. Transcribed B. Is transcribed as well as…
A: A sequence that is composed of nucleotides is known as a gene and it is known to encode a protein…
Q: True/False Question (suggested time - up to 1 minute): The amino acid sequence of a given protein…
A: Mutation is the sudden inheritable change in the genotype. The process by which the mutation is…
Q: All questions a) What is the DNA base sequence of Codon 1? b) What is the anticodon sequence for…
A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…
Q: rotein kinase inhibitors have become a major focus for the development of molecularly targeted…
A: Introduction: A substance that blocks the action of an enzyme is called protein kinases. There are…
Q: What must two different bacteria have in common for the same bacteriophage to be able to kill both…
A: A phage commonly known as bacteriophage is a type of virus that infects bacteria. The word "phage"…
Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: When large genomes are sequenced, which of the following is true? Group of answer choices The…
A: Genome is defined as the total complete set of an organism's DNA where it contains of all the…
Q: 64. Embryonic stem (ES) cells differ from somatic stem cells in that ... a) ES cells can only…
A: Embryonic stem cells can be derived fron embryonic tissues while adult stem cells from adult somatic…
Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…
A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…
Q: Question: Genetically modified animal that might be approved for human consumption is a super…
A: Introduction CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats. This is…
Q: Question:- How is the assembly of an antibody different than traditional forms of alternate…
A: Introduction: The B lymphocytes, which are antigenically activated, undergo blast transformation to…
Q: Question:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed…
A: In vivo processes are processes done within the cell.In vitro processes are processes done in an…
Q: What biological rationale can explain why there are so few variants observed at position 65 of the…
A: The iron atom in the heme group can form a total of 6 coordinate bonds . 4 of these are formed with…
Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?
A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…
Q: Type of Point Frameshift mutation Substitution Insertion or Deletion 10 (Circle one.) How did the…
A: Nucleus is chief controller of cell in which genetic information is safely stored . It exhibit long…
Q: Question Completion Status: A 2.0kb bacterial plasmid 'BS1030' is digested with the restriction…
A: Restriction enzymes cleave the DNA at palindromic sequences. Plasmids are circular DNA molecules.…
Q: Practice Question 2 The beginning of the hexose kinase gene's sequence can be found below, the +1…
A: DNA replication in is semiconservative, semi-continuous, and bidirectional. It occurs in the S phase…
Q: Describe an assay that could measure the activity of adenylyl cyclase (AC).
A: Introduction: Adenylyl cyclase (AC) is an enzyme that catalyzes the conversion of ATP to cAMP in our…
Q: Question- There are 2x10-3 mutations in every replication of a given strain of bacteria, and this…
A: Given information Number of mutations in one replication - 2x10-3 Time for one replication is = 30…
Q: Identify the best match between the mutation description and term.
A: As we know that there are 20 amino acids and the total codon are 64 of which 3 are stop codon. So we…
Q: Question-1 During DNA replication, a.No errors occur b.only one strand of the molecule acts as a…
A: DNA replication is a process by which a double stranded DNA molecule makes an identical copy of…
Q: If chemically competent E coli cells are disrupted by CaCL2 and a heat shock to take up DNA, how…
A: Calcium chloride heat-shock transformation is a powerful molecular biology technique used to…
Q: QUESTION :-Why is it important to validate cell research with translational potential in animal and…
A: Cells are basic structural and functional units of life. Millions and trillions of cells constitute…
Q: Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to…
A: The Central dogma of molecular biology involves the synthesis of RNA using DNA as template by the…
Q: Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation…
A: Biotechnology is a branch of science which use living organisms it alters or modify the genes and…
Q: Describe the path a cell surface receptor will take when being synthesized (starting at the…
A: Cell surface receptors are receptors that are located on the plasma membranes of cells. They…
Q: Describe how you could use CRISPR-Cas9 gene editing to alter a specific genomic DNA sequence in a…
A: CRISPR-Cas 9 is one of the most successful and commonly used gene-editing methods, where one guide…
Q: QUESTION 11 Which of the following statements about RNA interference pathways and mechanisms is…
A: Small interfering RNA are small, double stranded RNA molecules that may bind with the target…
Q: Question 3: Imagine that you isolated X-receptor MRNAS from mutant cells with the nonsense mutation…
A: Non-sense mutation Nonsense mutation also known as stop mutation is the mutation that causes a…
Q: what are the differences between mitochondrial RNA polymerase and RNA polymerase ? and why does…
A: *The mitochondrial transcription is a multi-component system consisting of, at minimum, the…
Q: Updates Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal…
A: Sickle cell anaemia is a genetic disease caused by an abnormal haemoglobin. The resulting change in…
Q: What is mutation? Distinguish between a gene mutation and a chromosomal mutation?
A: The genome is made up of one to several long DNA molecules, and mutations on these molecules can…
Q: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Part A) How does the molecular mechanism of elongation arrest by SRP differ between Bacillus and…
A: Introduction: The SRP targeting mechanism's co-translational nature is most likely to blame for its…
Q: What happens when p53 senses that DNA damage is beyond repair? Why is this advantageous?
A: Introduction: Tumor suppressor genes encode the proteins that prevent the cell to progress through…
Q: Describe how the Polycomb group proteins influence genome expression.
A: Polycomb proteins are first discovered in fruit flies I.e Drosophila melanogaster,during the…
Q: Viral vectors are not the only method being studied for gene therapy purposes. Which of the…
A: Viral vectors are used to transfer a segment of gene into the plasmid or the receipt DNA Many other…
Q: Reset Help defined as changes in the sequence of Mutations DNA frameshift mutations caused by…
A: a- mutagens (mutations caused by environmental factors) d- carcinogens (mutagens include cancer…
Q: theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People…
A: Single nucleotide polymorphisms are frequently called as SNPs and also pronounced as “snips”-most…
Q: Whole genome sequencing provides the most comprehensive genomic information. Nevertheless, there are…
A: DNA microarrays are a set of DNA probes that are arrayed on a solid platform and used to detect the…
Q: Cystic fibrosis is genetic disease caused by mutations in the CFTR gene. The consequence of this is…
A: Cystic fibrosis is a rare genetic disorder that occurs when there is an inherited mutation in cystic…
Q: A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA…
A: In this question we have to describe about codon and its translating amino acids. See full answer in…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- MRNA- based therapeutics The following questions: Which research group has initially developed the technology? What was the purpose behind the invention of the technology? What type of questions could be answered with the technology? What are the applications of the technology? Are there any clinical trials associated with the method? What is the mechanism of action for the technology?Situational task: As a result of intoxication, enzymes that provide splicing are not synthesized in liver cells. What is the reason for stopping protein biosynthesis in this case? Justify the answerInstruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
- True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.Drug 2-Lumacaftor (VX-809): In people with the most common CF mutation, F508del, a series of problems prevents the CFTR protein from folding into the correct shape and reaching its proper place on the cell surface. The cell recognizes the protein as abnormal and targets it for degradation before it makes it to the cell surface. In order to treat this problem, two drugs are required - an agent to get the protein to the surface and then Ivacaftor to open the channel and increase chloride transport. The drug Lumacaftor has been identified as a treatment to help with the trafficking of the protein to the cell surface. When Lumacaftor is added to Ivacaftor, the protein gets to the surface and also increases chloride transport by increasing channel opening time. For which class(es) of mutations would Lumacaftor be most effective?Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
- INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: RNA splicing is the step in post transcriptional processing where intervening sequences are removed STAMENT 2: 5’ to 3’ direction is the direction of growth of the peptide chain ANSWER: STAMENT 1: The enzyme that joins the gaps in newly synthesized DNA is called DNA polymerase STAMENT 2: The name of the compound formed when cytosine is bonded to ribose is cytidine ANSWER: STAMENT 1: Codon is a term that refers to the 3-nucleotide code for amino acids in mRNA STAMENT 2: Transition is a kind of mutation where a purine changes to another purine ANSWER:Please help and explain the following question...thank you! Describe instances when a DNA mutation would not alter the function of a protein. Describe instances when a DNA mutation would alter the function of a proteinQuestion. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:
- Genetics problem part 1. Part 2 attached in new question Draw and Label what is happening in this scenario: The antibiotic erythromycin disrupts protein synthesis by binding to the 50 S subunit and preventing ribosomal translocation. No other step in protein synthesis is affected. a. If you are performing an in vitro translation reaction and add erythromycin just before the 3rd bond that is about to be made and wait a few minutes to look at the ribosome, you will find which tRNA in site A? b. If you are performing an in vitro translation reaction and add erythromycin just before the 3rd bond that is about to be made and wait a few minutes, the ribosome should have the carboxyl end of amino acid #3 covalently bonded directly toINSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A CINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: UGA, UAG and UCG are termination codon STAMENT 2: Missense mutation is a type of mutation that changes the coded amino acid ANSWER: STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNA ANSWER: STAMENT 1: The carbon number in ribose where guanine is connected is 1 STAMENT 2: The other name for unprocessed eukaryotic RNA is raw nuclear RNA ANSWER:
