Question 2 coding strand is: 5'-TACGATCATAT-3’. This sequence is transcribed. What is the sequence of the corresponding RNA? The partial sequence of a gene |A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3' C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5' E 5'-TATACTAGCAT-3’

Question 2 coding strand is: 5'-TACGATCATAT-3’. This sequence is transcribed. What is the sequence of the corresponding RNA? The partial sequence of a gene |A 5'-UACGAUCAUAU-3’ B 5'-ATATGATCGTA -3' C 5'-AUGCUAGUAUA-3’ D 5'-AUAUGAUCGUA-5' E 5'-TATACTAGCAT-3’

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: QUESTION 13 Part of the sequence of a prokaryotic gene, including the translational start site, is…

A: DNA is a double helical structure with two helices bounded to each other. One strand is template and…

Q: QUESTION 31 Written from 5' to 3', the sequence of an RNA molecule made using the top strand of DNA…

A: INTRODUCTION Transcription is the process of making an RNA copy of a gene sequence. This copy,…

Q: QUESTION 21 You have the following coding sequence for a gene and need to generate billions of…

A: Polymerase chain reaction (PCR) is a fast in vitro method to amplify a given DNA sequence present in…

Q: Question 26 The initial event in the conversion of an hnRNA to the mature RNA which leaves the…

A: Answer is D

Q: QUESTION 12 The images shown depict the initiation and elongation steps in protein translation. P.…

Q: What is a promoter? a The site where the ribosome begins translation b The site where RNA…

A: Promoter: - Cis-acting (means non-coding gene) - Position dependent - Orientation dependent

Q: QUESTION NO. 1 Fragile X syndrome is a common form of inherited mental retardation. The mutation in…

A: Since you have asked multiple question, we will solve the first question for you. If youwant any…

Q: Question 8 The unique stem-loop structures of the transfer RNA helps the RNA perform its function of…

A: tRNA (Transfer ribonucleic acid) is one type of RNA that is used in translation machineri to decode…

Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…

A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…

Q: Which of the following best explains why there are 64 codons, but only20 amino acids for which they…

A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…

Q: Question 24 Tryptophan-repressor complex binds to operator O Gene is switched ON Gene is switched…

A: Tryptophan operon is a biosynthetic process in Ecoli in which group of genes that is associated with…

Q: Where does transcription occur in eukaryotic cells? a in the nucleus b in the cytoplasm c…

A: Transcription is the first step in protein synthesis and this process is responsible for mRNA…

Q: QUESTION 22 If polynucleotide phosphorylase (PNP) synthesizes random RNA when given a 50-50 mixture…

A: Codons are trinucleotide bases of DNA or RNA that code for specific amino acids. There are 64 codons…

Q: QUESTION 5 the heteroduplex region is a region that O any DNA that is double stranded O DNA contains…

A: Introduction: Recombination is the process in which there occurs physical exchange of the sequence…

Q: QUESTION 2 In order to compare transcript A and B expression levels in the same libarary based on…

A: Hi! Since you have posted multiple questions we will answer the first one for you. Please repost the…

Q: Question 16 All of these can be gene products except A tRNA B proteins (c) dsDNA D) FRNA E) MRNA

A: A gene product is the biological substance produced by the expression of a gene, which might be RNA…

Q: Question 9 How many amino acids are found in the polypeptide when the MRNA is translated? MRNA 5…

A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…

Q: Which of the following is not part of pre-mRNA processing in eukaryotes?

A: pre-mRNA processing is the process of converting a pre-mRNA into a functional mRNA that participates…

Q: Question 22 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…

A: DNA gyrase does the indispensable job of catalyzing the ATP dependent negative supercoiling of…

Q: Question 15 The higher protein abundance observed in the ACE20E allele compared to the wild- type…

A: Introduction The expression of genes is highly regulated in both prokaryotes as well as in…

Q: Question 6 the following DNA strand 5'-AACGATCATAT- 3' is: The complementary strand of |A…

A: Double stranded DNA is complementary to each other. This complementarity is governed by…

Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…

A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…

Q: Question 6 In eukaryotic transcription, both introns and exons are transcribed. A) True B) False

A: INTRODUCTION It is an process of transcription in the formation of a DNA strand is mainly copied…

Q: QUESTION 4 In eukaryotes, exons are O 1. spliced out of the original transcript. O 2. spliced…

A: DNA (deoxyribonucleic acid) is the genetic material of all the organisms on the planet except a few…

Q: Question 12 Which of the following best describes the assembly process to initiate translation in…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Question 93 Bonus: CRISPR-Cas 9 originally evolved as part of bacterial "immune response" against. O…

A: The CRISPR-Cas system is an immune system found in prokaryotes that provide resistance to foreign…

Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…

A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Q: Question 41 Elongation factor Tu (EF-Tu): A binds initiator tRNA and GTP. binds aminoacyl-tRNA in…

A: The synthesis of protein by using the information present in the mRNA is known as translation. The…

Q: QUESTION 20 Which of the following polymerases is found in the nucleolus? O A. DNA polymerase III O…

A: Polymerase enzyme is responsible for the process of polymerizing the monomers into polymers.

Q: QUESTION 19 A mutation inserts one nucleotide pair in the center of the open reading frame of a…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Question 26 hich of the following best describes the assembly process to initiate translation in…

A: Translation is defined as the process of synthesising of protein from the mRNA. It takes place in…

Q: Question 23 Repressor protein binding at DNA upstream O Gene is switched ON Gene is switched OFF…

A: The repressor is a small protein molecule that acts as the binding protein which inhibits the…

Q: QUESTION 17 Which of the following best supports the idea that the genetic code is composed of…

A: mRNA is produced by the process of transcription by action of RNA polymerase.

Q: QUESTION 1 Human ribosomes can translate the SARS-COV2 genome because: O it is reverse transcribed…

A: COVID 19 (Coronavirus disease 2019) is a pandemic disease that is caused by air-borne Severe acute…

Q: QUESTION 8 Why did you bother to identify the introns? O So that I could include them in the…

A: Introduction Introns This is a nucleotide sequence in the gene that removed by RNA splicing during…

Q: Question 10 The following statements best describes the RNA structure EXCEPT some eukaryotic RNAS…

A: RNA is produced from the DNA sequence by the transcription process in the nucleus of eukaryotic…

Q: Question 20 The initiation factors form a complex with RNA polymerase O Gene is switched ON O Gene…

A: The initiation factor form a complex with RNA polymerase when gene is switched on . when the gene is…

Q: QUESTION NO. 1 Antisense nucleic acids A. complementary to mRNA would enhance translation . B.…

A: Replication is considered as a process, in which new strand is synthesized over the template strand.…

Q: QUESTION 5 Genomic equivalence means that: O A. all related species share the same set of genes O B.…

A: Dolly is a transgenic sheep produced by fusing a mammary gland cell nucleus with an enucleated…

Q: QUESTION 11 Which of the following statements about RNA interference pathways and mechanisms is…

A: Small interfering RNA are small, double stranded RNA molecules that may bind with the target…

Q: QUESTION 6 The complementary sequence of 5' AATTCGOCTTA 3' is (note the polarity 5' and 3 of the DNA…

A: A DNA molecule is a double helix that has two anti-parallel strands intertwined with each other…

Q: Question 25 Which of the following RNAS is the product of transcription? A MRNA and tRNA only B FRNA…

A: Answer: D) mRNA, tRNA and rRNA. The product of DNA transcription is RNA it can be in the form of…

Q: Question 13 of 13 DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG…

A: DNA has two antiparallel strands of which one runs in 5'-3' direction and other in 3'-5' direction.…

Q: QUESTION 7 SR proteins bind to splicing enhancers and activate splicing by recruiting spliceosome…

A: SR proteins hepls in pre mRNA splicing. SR protein has two binding domain. RNA recognition motif…

Q: Question 1: The diagram below depicts an eukaryotic gene. In which region would the insertion of a…

A: A particular gene is transcribed into RNA by the process known as transcription and that RNA is…

Q: Which of the following best explains why each codon only codes for a very specific amino acid?…

A: The genetic codon is composed of three successive nucleotides present on the mRNA and the genetic…

Q: Which of the following best explains why there are 64 codons, but only20 amino acids for which they…

A: Which of the following best explains why there are 64 codons, but only20 amino acids for which they…

Q: Question 12 Alternative splicing A. happens when different set of exons are joined together B.…

A: Option d A,C,D,E

Q: Part A How can an isolated DNA bind to DNA on a column? What property allows the column to do this?…

A: DNA extraction/isolation is used for various biotechnological and microbiological studies. It is a…

Concept explainers

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’