Retrotransposons are nonviral genetic elements that facilitate their own movement within the genome (true or false) 2. Most mRNA molecules have an indefinite lifespan allowing high quantity protein synthesis from a single mRNA molecule (true or false) 3. spliceosome is a complex of RNA and protein that catalyzes the removal of exons from pre-mRNA (true or false

Retrotransposons are nonviral genetic elements that facilitate their own movement within the genome (true or false) 2. Most mRNA molecules have an indefinite lifespan allowing high quantity protein synthesis from a single mRNA molecule (true or false) 3. spliceosome is a complex of RNA and protein that catalyzes the removal of exons from pre-mRNA (true or false

Name: 1. Retrotransposons are nonviral genetic elements that facilitate thei
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. Retrotransposons are nonviral genetic elements that facilitate their own movement within the genome (true or false)2. Most mRNA molecules have an indefinite lifespan allowing high quantity protein synthesis from a single mRNA molecule (true or fal

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 8TYK

See similar textbooks

Similar questions

A cDNA and a cloned fragment of genomic DNA share sequences from a mouse gene. What differences do you expect to see between the cDNA and genomic DNA sequences? a. None; they should be identical. b. The genomic DNA might have an intron or introns. c. The genomic DNA might have promoter sequences. d. The genomic DNA might have a poly(A) tail. e. Both b and c are correct.
Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?
1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?
1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different colors, the direction, its components and the part of the cell where it occurs with the name of this stage. b) The sequence of the mature mRNA, indicating with different colors the structure of its components and the site of the cell with the name of the stage where it occurs. c) Mention the site of the cell where the bradykinin peptide was synthesized. d) In the DNA sequence make a point mutation by substitution, indicate with a different color the site and the effect it will have on the respective codon and to which amino acid it will be translated. 2. Based on the answer in (a), use the DNA sequence of bradykinin to describe the outcome of the replication step. 5. You have the picture of DNA transcription and mRNA translation between prokaryotic and eukaryotic cells.Instruction: Make a comparative chart showing the differences between the two cells. (image) 7. Methylations. Describe…
As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!
A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)
A gene with the following DNA sequence is transcribed and translated: 5’ TAGCTACGGAAAGCGTACACGGACT 3’ Briefly explain how the above mentioned DNA sequence will be transcribedto RNA.
5. While exploring the human genome, a geneticist happens upon a gene in humans that is not functional and is not currently being expressed. This gene appears to be similar to the genes found in modern monkeys that cause tail formation. The most likely explanation for this gene in humans is Group of answer choices a. The gene is lying in wait for when it will be needed and then activated when the opportunity arises b. The gene is a conserved gene that serves an essential function in modern humans c. Humans are likely evolving a tail, and the gene will be expressed in the future d. The gene Is a random mutation of no significance e. The gene is a pseudogene leftover from when human ancestors had a tail
1. What would be the amino acid sequence encoded by the mRNA5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?