Select the correct terms: The genetic code demonstrates (ambiguity / redundancy) because some amino acids are coded by more than one codon. The lack of (ambiguity / redundancy) in the genetic code is evidenced by the fact that each codon codes for one, and only one, amino acid.

Select the correct terms: The genetic code demonstrates (ambiguity / redundancy) because some amino acids are coded by more than one codon. The lack of (ambiguity / redundancy) in the genetic code is evidenced by the fact that each codon codes for one, and only one, amino acid.

Name: Select the correct terms: The genetic code demonstrates (ambiguity / r
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Select the correct terms: The genetic code demonstrates (ambiguity / redundancy) because some amino acids are coded by more than one codon. The lack of (ambiguity / redundancy) in the genetic code is evidenced by the fact that each codon codes for on

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Similar questions

Please please answer that full answer please What makes it possible to correctly start translation from an mRNA having multiple codons for methionine? Describe in context of eukaryotes and prokaryotes.
I have a presentation on the discovery of the genetic code, but I don't know how to organize my presentation.
Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart on the next page to answer the following questions. Partial gene sequence of DNA nucleotides: A C C T T A A T G A A C T C T 42. What is the mRNA nucleotide sequence that would result from transcription of the partial gene sequence of DNA nucleotides? 43. What is the protein amino acid sequence resulting from translation of the mRNA sequence from the previous question? 44. In the gene sequence of DNA nucleotides, guanine (G) is mistakenly replaced by adenine (A) during DNA replication. What type of mutation would this be considered based on how it occurred? ________ a) spontaneous b) gametic c) mutagenic d) carcinogenic 45. Consider the mutation from the previous question. If it occurred within a skin cell of the body, what type of mutation would this also be considered based on where it occurred? ________ a) gametic b) germline c) heritable d) somatic
A small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.
It asks to categorize the possible answers to a component of eukrayotic RNA, eukrayotic DNA or both:
Select the best answer or answers from the choices given: The information sequence that determines the nature of a protein is the (a) nucleotide, (b) gene, (c) triplet, (d) codon.
Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA
What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value. Please keep answer between 2-3 sentences
How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
A point mutation that changes a codon specifying an amino acid into a stop codon is called a
If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY