Some transcription regulators bind to DNA andcause the double helix to bend at a sharp angle. Such“bending proteins” can affect the initiation of transcrip-tion without directly contacting any other protein. Can youdevise a plausible explanation for how such proteins mightwork to modulate transcription? Draw a diagram that illus-trates your explanation.

Some transcription regulators bind to DNA andcause the double helix to bend at a sharp angle. Such“bending proteins” can affect the initiation of transcrip-tion without directly contacting any other protein. Can youdevise a plausible explanation for how such proteins mightwork to modulate transcription? Draw a diagram that illus-trates your explanation.

Name: Some transcription regulators bind to DNA andcause the double helix to
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Some transcription regulators bind to DNA andcause the double helix to bend at a sharp angle. Such“bending proteins” can affect the initiation of transcrip-tion without directly contacting any other protein. Can youdevise a plausible explanation for

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...

See similar textbooks

Similar questions

In eukaryotes, transcription initiation involves enhancersequences located far from the promoter. In addition, thechromatin of eukaryotic chromosomes must be unwoundto allow access by _________?
Cells go to great length to correctmistakes in the processes of DNAreplication, transcription, splicing,and translation. Are there analogousstrategies to correct mistakes in theselection of which genes are to beexpressed in a given cell type? Couldthe great complexity of transcriptioninitiation in animals and plants reflectsuch a strategy?
Many transcriptional activators are proteins with a DNA-binding domain (DBD) and an activation domain (AD). Explain how each domain contributes to transcriptional initiation. Would you expect repressors to also have each of these domains?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Determine if the concentration of transcription regulator were same in nucleus of eukaryotic cell as well as in bacterium, whether the binding of regulator be equal in both of these.
Outline the essential features of the three basic phases of transcription. How might each of them be targeted to regulate gene expression? Which of the three phases is the most common target of regulatory mechanisms?
A. Identify the mutation(s) that lead to the most loss in transcriptional activity, and discusswhether those match expectations based on the consensus sequence for the Initiator.B. Hypothesize a molecular mechanism to explain how the mutations identified in Part Aresult in loss of transcription activity.C. Identify whether any mutations cause transcription to initiate from a different positionthan wild-type, and provide a brief explanation as to why that occurs for those mutantcore promoters. THIS IS A PRIMER EXTENSION ASSAY
Mechanisms that inhibit TE activity include theproduction of transposition repressors throughalternative splicing and the action of _________ thatblock TE transcription.
Explain using leucine zipper motifs as an example, how protein-protein interactions between transcription factors containing such motifs can generate diversity in transcriptional activation. Refer to the recognition of DNA elements in gene promoters to justify your answer. Assume transcription factor A binds to DNA element A’, transcription factor B binds to DNA element B’, and so forth.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?
In 3-4 sentences eachExplain the difference between prokaryotic and eukaryotic transcription. Explain the difference between an activator and a repressor? Explain the difference between a promoter and an enhancer? Explain the difference between an intron and an exon? Explain what happens when eIF-2 is phosphorylated and when it is not phosphorylated?
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.