a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.

a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.

Name: a. Very few if any eukaryotic genes contain tractswith more than 25 As
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe terminat

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...

See similar textbooks

Similar questions

The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?
A. Identify the mutation(s) that lead to the most loss in transcriptional activity, and discusswhether those match expectations based on the consensus sequence for the Initiator.B. Hypothesize a molecular mechanism to explain how the mutations identified in Part Aresult in loss of transcription activity.C. Identify whether any mutations cause transcription to initiate from a different positionthan wild-type, and provide a brief explanation as to why that occurs for those mutantcore promoters. THIS IS A PRIMER EXTENSION ASSAY
. You are studying proteins having roles in translation inthe mouse. By BLAST analysis of the predicted proteinsof the mouse genome, you identify a set of mouse genesthat encode proteins with sequences similar to those ofknown eukaryotic translation-initiation factors. You areinterested in determining the phenotypes associatedwith loss-of-function mutations of these genes.a. Would you use forward- or reverse-genetics approaches to identify these mutations?b. Briefly outline two different approaches that youmight use to look for loss-of-function phenotypes in oneof these genes.
A single UASG regulates the expression of threegenes, all of which are adjacent: GAL7 and GAL10 asdescribed in Problem 8, and also GAL1.a. Would you expect these genes to be transcribedinto individual transcripts, or to be cotranscribed asone mRNA? Explain.b. How could you determine experimentallywhether each gene is transcribed separately orinstead that the three are cotranscribed into asingle mRNA?c. GAL1 and GAL10 are not only adjacent to eachother, but also are transcribed divergently with asingle UASG between them. Describe experimentsusing GFP and RFP transgenes that would allowyou to determine which of the four GAL4 bindingsites in this UASG element is (are) important for thetranscription of GAL1 and/or GAL10.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Cells go to great length to correctmistakes in the processes of DNAreplication, transcription, splicing,and translation. Are there analogousstrategies to correct mistakes in theselection of which genes are to beexpressed in a given cell type? Couldthe great complexity of transcriptioninitiation in animals and plants reflectsuch a strategy?
. Another class of suppressor mutations, not describedin the chapter, are mutations that suppress missensemutations.a. Why would bacterial strains carrying such missense suppressor mutations generally grow moreslowly than strains carrying nonsense suppressormutations?b. What other kinds of mutations can you imagine ingenes encoding components needed for gene expression that would suppress a missense mutationin a protein-coding gene?
Many promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Some transcription regulators bind to DNA andcause the double helix to bend at a sharp angle. Such“bending proteins” can affect the initiation of transcrip-tion without directly contacting any other protein. Can youdevise a plausible explanation for how such proteins mightwork to modulate transcription? Draw a diagram that illus-trates your explanation.
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).