Stem cells (cells with little or no determination) are useful in many kinds of biological research for which of the following reasons? Group of answer choices A. they do not have particular cell fates B. None of their DNA is methylated C. They have unique cytoplasmic determinants D. They have no microRNA

Stem cells (cells with little or no determination) are useful in many kinds of biological research for which of the following reasons? Group of answer choices A. they do not have particular cell fates B. None of their DNA is methylated C. They have unique cytoplasmic determinants D. They have no microRNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 21QP: Which of the following statements is not true about DNA replication? a. It occurs during the M phase...

See similar textbooks

Similar questions

Both DNA and RNA… a)move to different parts of the cell are b)nucleic acids c)are nucleic acids and information molecules d)are information molecules e)are nucleic acids, information molecules, and move to different parts of the cell
It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).
Unlike eukaryotic cells, prokaryotic cells ________. a. have no plasma membrane b. have RNA but not DNA c. have no nucleus d. a and c
Which of the following statements is not true about DNA replication? a. It occurs during the M phase of the cell cycle. b. It makes a sister chromatid. c. It denatures DNA strands. d. It occurs semiconservatively. e. It follows base-pairing rules.
A virologist is trying to make a new antiretroviral drug to treat HIV. In order to do so with the least side effects, he should target what? a. 80S Eukaryotic Ribosomes B. Reverse transcriptase C. DNA synthesis D. Cell membranes
which of the folowing will remove damaged cellular compnents? - post translational modification - apoptosis - hydroylsis - ubiquitination - autophagy
A cell is produced with a mutation that causes it produce a completely defective TFIIH. What does this likely mean for the fate of the cell? A) The cell's copied DNA may contain more errors. B) the cell cannot make RNA C) Producing RNAs will be slower because the polymerase will fall off the DNA more often. D) The cell cannot replicate its DNA
Muscle cells differ from nerve cells mainly because they(A) express different genes.(B) contain different genes.(C) use different genetic codes.(D) have unique ribosomes.
Consider a human lover cell vs a cheek cell: Explain whether the following components are identical/very similar in the two cells a. DNA b.mRNA c.tRNA
Which macromolecule is made by the enzyme reverse transcriptase? rRNA protein mRNA cDNA
What type of cells were concluded to be corrupted which constitutes a cell line when conducting cancer-related research? a. Stem cells b. RBC's c. ACF d. NIH 3T3
Sequence the steps to transfect and observe a fluorescent protein in a slice of the brain: * Place the slice of brain under the microscope and observe it. * Wait for the expression of the fluorescent protein by the transfected cells. * Harvest and culture a slice of brain. * Electropore in the slice a plasmid coding for a fluorescent protein.