Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the EcoRI restriction enzyme. Fragments averaging about 4 kb in length would be generated. Is this procedure suitable for cloning large genes? Why or why not?

Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the EcoRI restriction enzyme. Fragments averaging about 4 kb in length would be generated. Is this procedure suitable for cloning large genes? Why or why not?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 8QP

See similar textbooks

Related questions

Q: Which of the following cloning vectors have the minimal features required for cloning ? Answer =

A: Answer :: Brief description about cloning Cloning is a process that allows scientists to create…

Q: Why is genome database and annotation relevant to Genome sequencing? Are there any examples?

A: Genome: the set of genes. Genome database: it is the collection of all information on the human…

Q: Observations: Are bands present? If yes, what the approximate size in bp of each band? Results: Was…

A: AGE or the Agarose Gel Electrophoresis AGE is a technique that allows the separation of…

Q: You need to amplify a gene from a source DNA for cloning in any cloning vector, which enzymes will…

A: The method of DNA cloning is used to produce the multiple identical copies of the specific template…

Q: Match Column A with Column B F. v Analysis of genome-wide patterns of gene expression F. v…

A: Recombinant DNA technology - It is a technology which forms the desired DNA sequence of interest by…

Q: From your knowledge about DNA microarray, answer the following: Mention the name and the color of…

A: DNA microarray is basically a collection of microscopic DNA spots that are attached to the solid…

Q: Propose a method for isolating a DNA fragment that is adjacent in the genome to a previously…

A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…

Q: A DNA library is a collection of clones, each containing a different fragment of DNA, inserted into…

A: According to the question, A DNA library is a collection of clones, each containing a different…

Q: If you were working on the Human Genome project and trying to distinguish genes from transposons,…

A: The gene is the sequence of nucleotides and is the functional unit of heredity. Genes contain…

Q: (a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is…

A: The genetic code comprises the set of rules that tells how the four nucleotide bases in the DNA are…

Q: is it possible that pcr primers could bind and amplify a sequence of dna that is difference from the…

A: Polymerase Chain Reaction (PCR) is a technique that gives us multiple copies of desired DNA…

Q: If I clone a complete eukaryotic gene, including the eukaryotic promoter region, ligate it into a…

A: Transformation is the process in which a bacterium takes up DNA from the environment, that has been…

Q: a Given the following restriction map of a cloned 10 kb piece of DNA, what size fragments would you…

A: The process of fragmenting deoxyribonucleic acid strands with specific enzymes is restriction…

Q: To clone a bacterial lipase gene into the cloning vector pET28a, you know the full sequence of the…

A: For the ease of manipulation, vectors must be relatively small molecules. They must be capable of…

Q: a To make a genomic library useful for sequencingan entire genome, why would you ordinarily fragment…

A: Hi there! Since you have posted multiple questions, we are answering only first two sub-parts. A…

Q: How the Sequencing Technologies Have Progressed Rapidly ? Explain about this ?

A: Early efforts at sequencing genes ere troublesome, when Gilbert and Maxam reported the sequence of…

Q: Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting…

A: The process of cutting or cleaving DNA by using restriction enzymes is called digestion or…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: Calculate the average sizes and numbers of DNAfragments produced by digesting human genomic DNAwith…

A: DNA is the genetic material of many eukaryotic and prokaryotic organisms. It is a double-stranded…

Q: Briefly answer the question: Exome sequencing to identify a mutation that could cause a particular…

A: Primary findings are the testing results which are obtained and provide required information about…

Q: Why do we need to add “COLD” alcohol? What is the effect of the temperature of the alcohol in the…

A: DNA is extracted from various sources to study the sequence of the DNAs from various sources and to…

Q: What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The stringency of PCR amplification can be controlled by altering the temperature at which the…

A: PCR amplification is defined as the specific amplification of mostly DNA or RNA targets. This is…

Q: Explain why genomic DNA libraries require more colonies than are comprised by a single genome…

A: Genes are the units of heredity that are transmitted through generations. Genes contain the genetic…

Q: Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in…

A: The polymeric chain reaction (PCR) is a technique in which amplification of a specific DNA segment…

Q: AND Based on the knowledge you gained from the cloning module, which of the bands in the figure is…

A: Agarose gel electrophoresis is used to monitor the progress of a restriction enzyme digestion, to…

Q: "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?

A: Introduction The cDNA library is a collection of mRNA segments cloned into independent vector…

Q: Arabidopsis thaliana has among the smallest genomes in higher plants, with a haploid genome size of…

A: Biotechnology is the use of our understanding of biological processes to develop useful applications…

Q: Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the Eco…

A: The human genome project was started in the year 1990, the main objective of this genome project is;…

Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…

A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…

Q: One type of cancer is caused by a mutation that occurs in a gene whose length is 2kb. A 200bp…

A: Introduction The polymerase chain reaction, or PCR, is a chemical reaction used by molecular…

Q: The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: Restriction enzymes look for palindromic sequences of DNA to cut, how does it recognize those…

A: A restriction enzyme or restriction endonuclease is an enzyme that cleaves/cuts DNA into fragments…

Q: What is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.

A: Enzymes are substances produced by living organisms to carry out reactions at a high rate without…

Q: In conventional PCR applications, a heat-resistant polymerase is used. Why? You want to identify and…

A: "Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: "Whole-Genome Sequencing Is Widely Used for Sequencing and Assembling Entire Genomes". Explain this…

A: Whole genome sequencing It reveals an organism's complete DNA make-up ( allowing us to better…

Q: a. What type of nucleic acid and from what species would the scientist use to begin construction of…

A: a. answer... the scientist uses chromosomal DNA to begin the construction of her genomic DNA…

Q: How would you modify the Ames test to evaluate physical mutagens?Would it be necessary to add the…

A: Physical mutagens involve the radiation like ultraviolet rays, X rays, gamma rays and alpha and beta…

Q: Based on the knowledge you gained from the cloning module, which of the bands in the figure is…

A: Cloning modules allows you to have more control over which parts of the original module are…

Q: For each of the following experimental goals, is PCR orgene cloning preferable and why?a. Isolate…

A: Introduction The polymerase chain reaction (PCR) is a widely used method for rapidly making millions…

Q: You want to clone a 6,000 bp DNA fragment in E. coli. Which cloning vectors would be appropriate?…

A: Ans: The process or methodology of cloning of gene in the vector, its transformation in host E. coli…

Q: PCR errors during library amplification are one possible source of false positive results. If an…

A: PCR is a polymerase chain reaction. This is a biotechnology used to amplify the DNA copies.

Q: Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the…

A: Amino acids are the organic compounds that acts as the building block of protein molecules. Proteins…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the Eco RI restriction enzyme. Fragments averaging about 4 kb in length would be generated. Is this procedure suitable for cloning large genes? Why or why not?
What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.
Assuming that you start with one genome copy and are trying to amplify a 2000 bp DNA fragment, how many rounds of PCR do you need to do before you have products of the correct length?
Suppose you have been directed to find new enzymes to use in the breakdown of wood in order to process biofuel (switchgrass, for example). Suppose you wanted to use fungal or bacterial DNA from the environment in order to do so. DNA can be unwound from the double stranded double helix into single strands, amplified, separated on gels by size, stained with dyes. It can be mutated by a variety of means. It can be sequenced. Describe one or more of the ways that you might manipulate DNA towards the stated goal. Relate the technology you plan to utilize to the structure of DNA. (You can break this into multiple posts, as multiple procedures might be used).
What is the main reason for using a cDNA library rather than a genomic library to isolate a human gene from which you wish to make large quantities of the human protein in bacteria? How will you identify clones of interest?
Is it possible that two different restriction enzymes couldcut the human genome into exactly the same number offragments and with exactly the same distribution of fragment sizes, yet the ends produced by the two enzymescould not be joined together by DNA ligase? Explain
How the Sequencing Technologies Have Progressed Rapidly ? Explain about this ?
In PCR amplification Why is it important to know the length of the sequence you amplify?
In next-generation sequencing, which of these advances allows for massively parallel sequencing? a. Pieces of DNA are fixed to a surface, so we can tell which new nucleotides were added to each piece. b. DNA sequences are read in real-time as nucleotides are added to each piece. c. Each segment of the genome can be pieced back together through shotgun alignment d. Single molecules of DNA can be read without the need for amplification.
Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?
Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'
(a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is the advantage of Illumina Next Generation Sequencing?