Suppose that in maroon-fronted parrots, the number of chicks born each year in a population is compared to the number of predators in the same area. Correlation coefficient = -0.1 Number of predators From the correlation analysis, is there strong evidence that the number of predators affects the number of parrot chicks? Yes, because the number of chicks decreases as the number of predators increases. No, because the correlation coefficient is close to zero. Yes, because correlation analysis is used to determine the effect of one variable on another. O No, because correlation analysis does not determine if there is a causal link between the two variables. Number of parrot chicks

Q: Epiphytes: Epiphytes have adapted to grow without soil in the canopy layer in a tropical rainforest.…

A: Epiphytes are also known as "air plants" because they are not held on to the forest floor. They grow…

Q: Peripheral proteins are proteins in the lipid layer facing inside the membrane True False

A: Cell membrane also called as plasma membrane are generally made up of by phospholipid bilayer in…

Q: i) Describe and explain i) the role that flight plays in creating these kinds of viruses, ii) how…

A: Bats are classified into mammals with the order Chiroptera. Bats forelimbs are adapted as a wings…

Q: . Give the pathology in : 1 sentence each only g. purpura simplex h. Hereditary hemorrhagic…

A: Pathology can be defined as a branch of science which deals with the study of disease,its cause,…

Q: The circulatory system has 5 functions. · Highlight the statements below that are only functions of…

A: There are two types of circulatory system open circulatory system and closed circulatory system.…

Q: Promoters and enhancers are important regulatory sequences for many eukaryotic protein- genes. Which…

A: Transcription is the process of forming transcripts or RNA from DNA through complementary base…

Q: These describe sea daisies EXCEPT A. Common name is sea daisy B. Usual position in its natural…

A: Sea daisies make up an unusual group of deep-sea taxa belonging to the phylum Echinodermata, with…

Q: 9) What IS the effect of exercise on BP? How does the body benefit from this change in BP during…

A: 9) when we exercise the blood pressure rises. This occurs because during exercising out body cells…

Q: Question 31 What directly or indirectly determines the transition temperature? O the ability of…

A: Biomolecules are the fundamental building components of all living things. They play an essential…

Q: Match lipid structures in column A with its lipid type in column B. esters of fatty acids with long…

A: Please follow step 2 for detailed explanation.

Q: 1. A primitive character is known as a. plesiomorphy b. apomorphy c. synapomorphy d. amorphy 2. What…

A: Q1. A primitive character is known as   a. plesiomorphy b. apomorphy c. synapomorphy  d. amorphy   Q…

Q: age In the excretory system, blood is filtered and concentrated to form urine, which exits the body…

A: The human body is made up of many types of cells, tissues, and organs. To maintain a healthy…

Q: What kind of membrane protein is found entirely outside the bilayer on either the extracellular or…

A: Introduction  Peripheral proteins are membrane proteins  which attach only temporarily to the…

Q: 1) Explain why the process of DNA replication is slower on the lagging strand than on the leading…

A: DNA replication is a process in which from one Duplex DNA ,two identical copies of DNA is…

Q: a mutant screen in Drosophila, you identified a gene related to memory, as evidenced by the…

A: Recombination is a crucial term in biology. It is necessary for the creation of gene variants. The…

Q: Which is NOT true about sand dollars? A. originally posses spines but lost it as the organism…

A: Sand dollars belong to the echinodermates. They have radially symmetry. The body is divided into…

Q: Relate the anatomic feature(s) of the four functional zones of the neuron with their function

A: ANSWER;-

Q: One difference between mitosis and meiosis is

A: Cell division is a metabolic process during which parent cell undergo splitting phenomenon and give…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Answer the following: a. What is a nutrient cycle? b. What are the different types of nutrient…

A: As the name itself suggests, it is basically a repeating process of a selective nutrient of…

Q: m 20 ycerides and cholesteryl esters are transported in the core of plasma lipoproteins. True False

A: Absorption and digestion of dietary fats is helped by lipoproteins. Cholesterol, cholesteryl esters,…

Q: Which of the following is NOT a characteristic of the exoskeleton of an arthropod? A. Always laden…

A: Arthropoda is the largest phylum in the animal kingdom and contains insects. Their bodies are…

Q: What determines the maximum rate of Action Potential firing?

A: The answer to this question lies in the dynamics of forces of an ion. Overall, the maximum firing…

Q: What role do hydrogen ion play in the generation of ATP in cellular respiration

A: Cellular respiration is a group metabolic process used by every living organism to produce energy in…

Q: With respect to wobble hypothesis all of the following are correct except: An inosine nucleotide in…

A: The translation process is started by ribosomes. Ribosomes are made up of bigger and smaller…

Q: Which is part of a group of predatory insects? A. Isoptera B. Odonata C. Orthoptera D. Blattaria

A: Insects are pancrustacean hexapod invertebrates of the class Insecta. They are the largest group…

Q: Question 10 Which of the following statements is incorrect? O In delta notation of fatty acid…

A: Q. Which of the following statements is incorrect?   1.In delta notation of fatty acid…

Q: 48 49 5

A: 48. Two steps taking place in PhotoPhosphorylation are : - Hydrolysis of ATP Reduction of NADP

Q: Shown below are single-stranded DNA probe and target sequences. Where on the target sequence will…

A: In cells, DNA (Deoxyribonucleic acid) is the nucleic acid that functions as the original blueprint…

Q: Write a paragraph explaining either hemodialysis or peritoneal dialysis. You must use the following…

A: INTRODUCTION In hemodialysis the entire blood from your body is filtered by a machine which is…

Q: In rabbits, short hair (S) is dominant over lang hair (s). What genotype and phenotype ratios are…

A: The cross is between two heterozygous short haired rabbits. Here s is Dominant ove S. So, Ss × Ss…

Q: by Rhizobium species?

A: Answer is P,R and S.   Nodulation factors (Nod factors) are chitooligosaccharides produced by…

Q: One would be correct in assuming that the restriction sites present in the multiple cloning site of…

A: In E. coli, pUC18 is a widely used plasmid cloning vector. The molecule is a circular…

Q: Put the following events involved with protein synthesis in order. Move first event to the top of…

A:

Q: Explain how mismatch repair fixes incorrectly matched base pairs.

A: To explain: To explain how mismatch repair fixes incorrectly matched base pairs

Q: Which of the following could be reasons why population sizes may reach and maintain plateaus? Select…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: A fontanelle is a meeting place of sutures. How many sutures open into the anterior fontanelle? 01 2…

A: The fontanelle is basically a meeting point of sutures. The anterior fontanelle is the largest one…

Q: Consider a bacterium that can synthesize an imaginary amino acid called fictamine. Initially,…

A: ANSWER;-  i) Gene Y codes for enzyme 1 because when gene Y is mutated, the activity of enzyme 1 is…

Q: What are some things to look for in secondary sources to help you identify if they are good sources…

A: biology's primary source literature: original research results are written by those who conducted…

Q: Examine carefully the given plane DNA model below and fill out the required information by…

A: Self replicating biomolecules that are present in the chromosome and carry genetic information are…

Q: Susan Husband healthy Affected healthy Affected

A: Sickle cell anemia is an autosomal genetic disease and it is inherited as an autosomal recessive…

Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…

A:

Q: 1. Cite examples of plants that you can identify as monocot or dicot based on the appearance of its…

A: Monocots and Dicots are the two types of vascular plants. The quantity of cotyledons is the most…

Q: 1. It is the creation of an offspring by fusion of haploid gametes, male sperm and female eggs, to…

A: Introduction Reproduction:- It is the process of producing new individuals of the same kind, an…

Q: How much of each ingredient (in kg) should be used in order to satisfy the protein requirement of…

A: CP, i.e., Crude Protein is a measure of the amount of protein in a feed.  The CP of soybean meal is…

Q: For each of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain…

A: Histones are proteins that package and protect DNA. They are subject to a variety of modifications,…

Q: (assuming they exist) where do they evolve? And explain pls.

A: Mermaids are imaginary creatures which have the upper part of the body as human and lower part of…

Q: 92. Which of the following is the most prominent ultrastructural characteristic of interstitial…

A: The Leydig cells are present in the testes. The major function is the production of androgen and…

Q: Next Which of the following is true about integral proteins according to the fluid mosaic model?…

A: According to the fluid mosaic model there are different types of proteins within the membrane.…

Q: Question 41 The model describes the cell membrane as an assortment of integral proteins suspended…

A: Introduction:- The cell membrane, also known as the plasma membrane, is a thin membrane that…