Suppose there are three tubes containing following samples in the laboratory. The three tubes are unlabeled and are shuffled. How will you identify DNA, RNA and Protein containing tube with naked eye? Support your answer with proper reason. DNA RN Protei 1 A2 n3

Suppose there are three tubes containing following samples in the laboratory. The three tubes are unlabeled and are shuffled. How will you identify DNA, RNA and Protein containing tube with naked eye? Support your answer with proper reason. DNA RN Protei 1 A2 n3

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 3CT: The results of a paternity test using short tandem repeats are listed in the table below. Whos the...

See similar textbooks

Related questions

Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…

A: The double standard DNA molecule is produced by the action of DNA volume range and the process…

Q: If a double stranded DNA has 30 percent of cytosine, calculate the percentage of adenine in DNA

A: Introduction: DNA, or deoxyribonucleic acid, is the hereditary material in humans and nearly all…

Q: Sort the size (bp) of DNA fragments on this gel from small to large. 1 smallest and 4 = largest. B

A: Electrophoresis is the method in which the dispersed particles show motion that is related to the…

Q: If amounts of bases in a DNA molecule are measured, we find OT = A and C = G. OA = C and G = T. %3D…

A: DNA (Deoxyribonucleic acid) is a genetic material present in the nucleus of eukaryotic cell.

Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…

A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…

Q: Which two of the components of DNA form the backbones of the DNA molecule? (Choose the one correct…

A: The DNA or deoxyribonucleic acid is a double stranded nucleic acid, composed of nucleotides. It is…

Q: According to Chargaff's observations of nucleotide composition of DNA samples OA % of (G + C) + % of…

A: Chargaff's rule has been stated for the DNA, which states that the ratio of purine and pyrimidine…

Q: A reaction mixture contains DNA polymerase, the four dNTPs, and one of the DNA molecules whose…

A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…

Q: During DNA replication, the Okazaki fragments are Select one: O a. single-strand RNA O b. RNA-DNA…

A: Option c

Q: Which of the following combinations are true of the nucleotide composition of a sample of DNA?…

A: Deoxyribonucleic acid (DNA) is the chemical name for the molecule that carries the genetic…

Q: Using recycled papers and sticks, demonstrate the steps of DNA replication. Use the following…

A: During replication, a double-stranded DNA molecule is duplicated to produce two identical DNA…

Q: A DNA molecule consists of 500 nitrogenous bases, of which 150 are G bases. So, the percentage of…

A: The four kinds of nucleotides existing in double helix DNA are adenine (A), thymine (T), guanine (G)…

Q: What feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the…

A: Introduction: Gel electrophoresis is a molecular technology that helps to separate the DNA fragments…

Q: Which of the following statements is false?a) BAC is a circular DNA moleculeb) YAC is a linear DNA…

A: Cloning vectors must be a DNA sequence with low molecular weight and must be able to multiply…

Q: A double-stranded molecule of B DNA contains 340 nucleotides. What information do you know based on…

A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…

Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…

A: Nucleic acids are one of the four main classes of biomolecules synthesized from monomeric units…

Q: DNA strands that can form a double helix are said to be Select an answer and submit. For keyboard…

A: Deoxyribose Nucleic Acid or DNA is a double-stranded molecule with the shape of a twisted ladder.

Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…

A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…

Q: suppose there are three tubes containing DNA RNA and protein samples in THE laboratory. the three…

A: Introduction: Those biomolecules that require in large amount to keep the body fit and healthy are…

Q: Given the graph, how big would a fragment of DNA be that travelled 20mm on a gel? 10000 Boco 4000…

A: In this graph Y axis is the size of DNA fragment in base pair. And X axis is the distance travelled…

Q: Put the following pieces of DNA in order that they would appear reading from the top (nearest the…

A: First of all lets convert all of them into single unit 1kb = 1000bp So, 21000bp =21kb 10000bp = 10kb…

Q: Four nucleic-acid samples are analyzed to determine the percentages of nucleotides they contain.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: Which of the following statements are true about double-stranded DNA? Write TRUE or FALSE 1. A+G=C+T…

A: DNA is a double stranded molecule with complementary base pairing. Complementary base pairing occurs…

Q: DNA Fragments: CGATCT TCACGA AGCTGC GGCTAA ATGCTG GTACCA Select the correct fragments from the…

A: DNA is a nucleic acid that is present in the nucleus of eukaryotic cells and the nucleoid region of…

Q: Fill in the table to describe the base pairing rules DNA DNA A Base pair G DNA 000

A: The rules of base pairing are- -->A with T, the purine adenine (A) always pairs with the…

Q: הנא (b) A section of DNA was analysed and 24% of its bases were found to be adenine. Calculate the…

A: DNA is a polynucleotide molecule made up of 4 types of nucleotides according to the nitrogen bases…

Q: In this diagram of a DNA electrophoresis gel, which sample contains the smallest molecules? АВСD в с…

Q: During the process of Gel Electrophoresis, DNA will move through the gel towards the-------end of…

A: DNA is the genetic material. It is responsible for regulating cell activities.

Q: Write the sequence of the DNA strand complementary to the following strand:…

A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…

Q: Adenine and thymine are complementary base pairs. The two strands are anti-parallel. The base…

A: DNA are the molecule that carries genetic information in all living things.

Q: A student was analyzing the base composition of a DNA sample, but has lost all the data except the…

A: DNA nucleotide base structure: Each individual unit of the DNA nucleotides is made up of a…

Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…

A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…

Q: complementary DNA sequence

A: Answer: Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded…

Q: of the following DNA models is accurately labeled? a. b. A d. 3'

A: The molecule found inside cells that holds the genetic information necessary for an organism's…

Q: Suppose a region of DNA is 100 bp long. How many unique sequences could it potentially represent?…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms that contain specific…

Q: Type the matching bases below in each DNA sequences. A T T C G A C G T C

A: DNA sequence composed of a row of chemical building blocks - called "bases". There are four types of…

Q: Write the base sequence in a complementary DNA segment if each original segment has the following…

A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…

Q: A researcher combines a variety of molecules needed for DNA replication. After adding DNA to the…

A: The correct option is (A) DNA ligase

Q: Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Use Chargaffs Rule to determine the percentage of base T in a sample of DNA that is 28% A and 22% C.…

A: Chargaff observations on the base pairs lead to some rules that help calculate the percentage of…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

A: DNA molecule is a polymer of nucleotides and each nucleotide has three main components that are…

Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…

A: Genomic DNA and plasmid DNA are isolated using silica resin columns than using traditional…

Q: The first base shown in this chromatogram is closest to to : : : : 71 MW Select an answer and…

A: Asked : Correct option for 1st base in the chromatogram is closest to which end of DNA.

Q: What was the first, DNA or RNA? Justify your answer with solid reason

A: The DNA replicates itself from the template itself using the DNA polymerase. The RNA is transcribed…

Q: hy is there a difference between how the DNA looks between a whole food sample (strawberry or peas)…

A: Genes can be found in any food, whether it comes from plants or animals. The majority of the DNA in…

Q: Identify the false statements. There may be more than one correct answer. A) The binding of DNA to a…

A: High quality DNA means that A260/A280 ratio is between 1.8 to 2 whereas a ratio closer to 1.8 is…

Question

5. Suppose there are three tubes containing following samples in the laboratory.
The three tubes are unlabeled and are shuffled. How will you identify DNA, RNA
and Protein containing tube with naked eye? Support your answer with proper
reason.
DNA
RN
Protei
1
A2
n3

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments phosphodiester linkage
1. what are the three main steps of a solid phase DNA extraction? Answer is Lysis, but does not include precipitation and purification 2. ) Most STR fragments used in human forensic analysis are composed of _____ repeats.
1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What if the DNA has 2.5 A260/A280 ratio?
1) What DNA base sequence is complementary to the following DNA sequence?TAGCGTGCATGGTGCTTAAC2) What RNA base sequence is complementary to the following RNA sequence?UAAUAGCUUGCUGAU
3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase Reverse transcriptase RNA Polymerase Endonuclease 6. Sanger DNA sequencing relies on a method known as chain termination. Which molecule is used to terminate DNA chains to create molecules of all possible lengths covering the fragment to be sequenced? Deoxyribonucleotides Deoxyadenosine Deoxyguanosine Dideoxynucleotides
1. The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of extracting DNA in biotechnology facilities. Describe how the extraction methods used in this lesson compare to those of research laboratories.
1. TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand. b) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand.
#4 under Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases D. new complimentary strand of DNA
1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences (b) Involves joining a donor DNA fragment of interest to a vector Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences
2. Which of these statements is INCORRECT about restriction enzymes Restriction enzymes form phosphodiester bonds when DNA are assembled Palindromic sequences are recognized by restriction enzymes Restriction enzymes recognize blunt ends Restriction enzymes recognize sticky ends Restriction enzymes originated from bacteria
1.) A portion of a strand of a much longer molecule has a nucleotide sequence AGC – AGG – CAG - ATC, if this strand is replicated, what will be its complimentary strand? a.)TCG – TCC – GTC - TAG b.)AGC - AGG – CAG - AUC c.)AGC – AGG – CAG - ATC b.)UCG – UCC – GUC – UAG 2.)If the environment gets cold, we often shiver to____ a.)decrease body temperature b.)keep body temperature the same as the external temperature c.)regulate blood pressure d.)increase body temperature 3.)How does a neuron transmit a message from cell to cell? A nerve impulse travel_ a.)from the end of the axon, through the cell body up to the dendrite’s terminal, then across the synapse to the axon of another neuron b.)from the dendrites of one neuron to the dendrites of another neuron passing the cell body to the synapse of the axon c.)from the end of dendrite, through the cell body, down the axon terminals, then travels across the synapse to the dendrite of another neuron d.)from the axon of one neuron to the…