1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences (b) Involves joining a donor DNA fragment of interest to a vector Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences
Q: A piece of human DNA is treated with two common restriction enzymes. The DNA piece in question is 50…
A: Restriction enzymes are a specific group of enzymes that can recognize a specific short sequence of…
Q: PCR is a very useful method in biotechnology because it does not require the 6 or more different key…
A: PCR is a polymerase chain reaction- it ia process of replication of DNA in laboratory. PCR can…
Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…
A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…
Q: Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific…
A:
Q: Enzyme that joins the DNA fragments Recombinant DNA Technology Restriction enzymes…
A: Technological Advancements in the field of Biotechnology and Sciences have allowed the humans to…
Q: 5.Statement 1: Restriction enzymes are sequence-specific, which means that they only recognize a…
A: Restriction enzymes also known as restriction endonucleases are the DNA cutting enzymes that are…
Q: Enzymes used to cut genes in recombinant DNA research are known as ____. a. DNA polymerases b.…
A: Enzymes Protein molecules that act as catalyst in a biological processe or reaction.
Q: How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is…
A: Note-We are supposed to answer only 1 question as per Bartleby guidelines. Kindly, repost the other…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: In nature, the purpose of restriction enzymes is to O A. Protect the bacterium from virus attack by…
A: Restriction Enzymes Restriction enzymes (endonucleases) cut DNA at specific sequences. They broken…
Q: SNP-chips are used ____. a. with short tandem repeat profiling b. to sequence DNA. c. in…
A: SNP array is very useful tool for study of slight variations between whole genomes.The most…
Q: Why is it important to sequence positive clones derived from PCR cloning? Group of answer choices
A: PCR is a technique of amplification of a given molecule of DNA to increase its copy number.
Q: RECOMBINANT DNA BRIEFLY, DESCRIBE RECOMBINANT DNA AND GIVE ONE CONCRETE EXAMPLE. EVALUATE THE…
A: Through recombinant DNA technology, we can clone our desired gene into a plasmid to get the desired…
Q: A student carries out PCR using the following steps: step 1: 94C for 1 minute Step 2: 60C for…
A: A complete set of chromosomes in any species is regarded as its genome. Each chromosomes homes DNA…
Q: Would it be possible to use human polymerase for the PCR reaction? a. No, because human polymerase…
A: Introduction The polymerase chain reaction is a process for making millions to billions of copies…
Q: The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction…
A: The segment of DNA shown in the figure has restriction sites I and II, which create DNA restriction…
Q: A researcher wants to cut this piece of linear DNA. 5'…
A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…
Q: 4. Animation 12.4: This table shows results from a genetic test conducted on DNA samples from two…
A: Restriction enzymes are the enzymes capable of cutting double-helical segments that contain a…
Q: 2. Which of these statements is INCORRECT about restriction enzymes Restriction enzymes form…
A: Restriction enzymes originated from bacteria
Q: What does the denaturation step in a PCR reaction accomplish? Group of answer choices Breaks the…
A: The correct option is Breaks the hydrogen bonds holding the base pairs together. In molecular…
Q: Why is it necessary to use a special DNA polymerase(Taq polymerase) in PCR?
A: PCR (Polymerase Chain Reaction) is a technique that is used to amplify specific DNA sequences. The…
Q: How would we amplify the target DNA associated with PTC tasting? O We use restriction enzymes to…
A: PCR polymerase chain reaction, is the most useful invitro techniques nowadays to amplify double…
Q: There are three classes of restriction enzymes; Class I, Class II and Class II. Nevertheless, Class…
A: Restriction endonuclease are the enzyme which make a cut in genetic material that is DNA somewhere…
Q: Briefly Explain the role of restriction enzymes in recombinant DNA technology. Please explain at…
A: DNA is a type of nucleic acid that is available in the nucleus of the cell. It is the chemical…
Q: 2. Your Genetics professor gives you and your classmate's information on a restriction digest. The…
A: The advantages of biotechnology for our society can be in drug manufacturing at a low cost using…
Q: Suppose that a geneticist discovers a new restriction enzyme in the bacterium Aeromonas ranidae.…
A: Restriction enzymes or restriction endonucleases are the enzymes that cut the DNA strand at specific…
Q: 1. a. What is PCR? Explain/relate its importance in DNA marker analysis. 1.b. What are restriction…
A: A restriction enzyme is a bacterial protein that cleaves DNA sequences at sequence-specific sites,…
Q: The ingredients used in PCR will contain all of the following except: Group of answer choices A.…
A: The PCR or Polymerase chain reaction is a widely preferred laboratory technique which is used to…
Q: All of the following are needed for PCR except: A) dNTP nucleotide monomers B) Oligonucleotide…
A: The polymerase chain reaction (PCR) is a special process that is used for the amplification of…
Q: Most PCR reactions do not use the more expensive types of DNA polymerase, which have DNA…
A: DNA polymerases inside the cell, especially the polymerases I, II, and III, have proof reading…
Q: Please answer these two questions regarding PCR: a) Why do you need to perform PCR on DNA obtained…
A: The polymerase chain reaction (PCR) is a technique used to make many copies of a specific segment of…
Q: Another restriction enzyme is called HaellI. It cuts DNA at the following base sequence: CCGG GGCC…
A: restriction enzymes are those enzymes which helps in cutting dna at specific locations .
Q: After DNA unwinds and becomes single-stranded in a PCR reaction, the temperature is lowered to allow…
A: Polymerase chain reaction ( PCR) is a technique that are used in amplification of specific DNA…
Q: Dr. Doom has a DNA sequence of 2000 bp. Enzyme X and Enzyme Y restriction sites and their positions…
A: Restriction enzymes are the enzymes which cut DNA at particular site.
Q: double-stranded length of DNA is exposed to a restriction enzyme. The enzyme finds 3 recognition…
A: Restriction enzymes Restriction enzymes are the specific enzymes that cleave the DNA in very…
Q: n Cohen-Boyer’s recombinant DNA procedure, ___i___ must be used for both the bacterial DNA and the…
A: The Cohen-Boyer experiment was to construct recombinant plasmids carrying the rRNA gene from the…
Q: Choose the one answer that fits best. Which statement regarding Molecular Biology is NOT correct…
A: Molecular Biology This is the field of biology which deals with the composition, structure and the…
Q: As you learned in this chapter,restriction enzymes are sophisticated“scissors” that geneticistsand…
A: Making many, exact copies of a specific segment of DNA is known as DNA cloning. The gene or other…
Q: For DNA amplification using PCR to occur, which of the following are needed? A. DNA primers…
A: The term polymerization stands for the production of a large chain or network-like molecules, from a…
Q: Definition of Terms( This is all about Applications of Recombinant DNA) a. Clone b. Plasmids c.…
A: Dear student, we are authorized to answer three subparts at a time, since you have not mentioned…
Q: Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the…
A: PCR, or the polymerase chain reaction, is a technique used by molecular biologists to amplify…
Q: Please answer both parts, a. The enzyme that catalyzes the joining of fragments to form recombinant…
A: The recombinant DNA technology is a branch of biology that deals with different techniques that…
Q: PCR (polymerase chain reaction) is an excellent method of generating copies of target DNA. If a…
A: Polymerase Chain Reaction, or simply PCR is a tool used in molecular biology to amplify a given…
Q: What is the purpose of restriction enzyme? 2. What is the purpose of the probe in DNA finger…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…
A:
Q: Can you think of any potential benefits of AFLP analysis over RFLP? Explain your reasoning.
A: AFLP is Amplifies fragment length polymorphism. It is a DNA typing method in which restriction…
Q: You isolate bacterial DNA from an unknown species, and use a PCR primer that amplifies DNA only from…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: PCR is essential for Select one: A. allowing restriction enzymes to cut DNA. B. making many copies…
A: Polymerase chain reaction (PCR) is a typical research facility method used to make many duplicates…
1.
(a) Restriction sites are usually ______.
|
Recombinant DNA Technology
|
||
|
Restriction enzymes
|
||
|
Ligase
|
||
|
Palindromic sequences
|
(b) Involves joining a donor DNA fragment of interest to a vector
|
|
|
Recombinant DNA Technology |
|
|
|
Restriction enzymes |
|
|
|
Ligase |
|
|
|
Palindromic sequences |
Step by step
Solved in 2 steps
- Chromosomal DNA fragments for molecular cloning are cut by _________, and inserted into molecular vectors (such as plasmids) using __________. a. Ligase; Restriction Endonucleases. b. Restriction endonucleases; Ligase. c. DNA polymerase 1; Primase. d. DNA polymerase 1; Ligase. e. Primase; Helicase.On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img) i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples? ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?Restriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA?
- You digested genomic dna with two restriction enzymes, Hinf I and Rsa I. These enzymes are used because: a. These enzymes recognize sequences TTAGGG present in TRF (terminal restriction fragment) at the ends of human chromosomes. b. These enzymes do not recognize sequences present in human telomeres' TRF (terminal restriction fragment). c. These enzymes are not expensive and very stable, making it possible to use them in a student laboratory course. d. These enzymes will not cut human genomic DNAA DNA fingerprint is based on _____. a repeating sequences found on noncoding regions b the presence of restriction enzymes c a single repeating region d repeating sequences found on coding regionsIn Cohen-Boyer’s recombinant DNA procedure, ___i___ must be used for both the bacterial DNA and the amphibian DNA ___ii___ a) the same restriction enzyme; so that the restriction sites are identical in the DNA of each species b) different restriction enzymes; So that the genes outside the restriction site are maintained c) different restriction enzymes; to ensure that the newly introduced genes are maintained in the bacterial DNA d) the same restriction enzyme; to ensure that the newly formed DNA can replicate
- 2. Which of these statements is INCORRECT about restriction enzymes Restriction enzymes form phosphodiester bonds when DNA are assembled Palindromic sequences are recognized by restriction enzymes Restriction enzymes recognize blunt ends Restriction enzymes recognize sticky ends Restriction enzymes originated from bacteriaRestriction enzymes and DNA ligase play essential roles in DNA cloning. How is it that a bacterium that produces a restriction enzyme does not cut its own DNA? Describe some general features of restriction sites.Some restriction enzymes produce DNA fragments with overhanging stretches called sticky ends on each strand. Sticky ends are useful in making recombinant DNA because Select one: a. Sticky ends contain the exact same nucleotides that allows fragments to splice together. b. Sticky ends contain nucleotides with complementary bases that allows fragments to splice together. c. Sticky ends contain the exact same nucleotides that can form hydrogen bonds. d. Sticky ends contain nucleotides with complementary bases that can form hydrogen bonds.
- Definition of Terms( This is all about Applications of Recombinant DNA){ 2-3 sentences only) a. Clone b. Plasmids c. Biotechnology a. PCR Amplification b. Detection c. Modified Trait d. Human Genome e. Genetic Modified OrganismA small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained.Please answer these two questions regarding PCR: a) Why do you need to perform PCR on DNA obtained from a crime scene? b) Why so forensic labs analyze non-coding DNA rather than genes?
