Q: 52. The major structures of the mesolimbocortical dopamine pathway include: Group of answer choices ...
A: This dopaminergic pathway connects the nucleus accumbens, amygdala, hippocampus, and prefrontal cort...
Q: The following is a section of DNA removed from a cell nucleus: 5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTT...
A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up ge...
Q: one specific example of each type of sexual selection
A: Introduction : Natural Selection Is The Process Through Which Individuals With Various Phenotypes Su...
Q: Describe the primary functions of helper T cells and cytotoxic T cells.
A: T cells are one of the most important white blood cells in the immune system, and they play a critic...
Q: Compare and contrast the definitions of mutualism, commensalism, and parasitism.
A: Introduction :- Mutualism is a beneficial relationship between creatures of two different species. M...
Q: A Photo credit: BSP3D- Group 5 Pharm. Bio. Sci 3 Laboratory (S.Y. 2016-2017) Sample is Bacillus subt...
A: Introduction :- Bacillus subtilis, often known as hay bacillus or grass bacillus, is a Gram-positive...
Q: Answer the following question based on the information provided: What are the genotype frequencies? ...
A: Trait is a characteristic feature that is unique to a specific individual . In this , flower colour ...
Q: which af inthe use of dendrimers in delivery the fell owing îs impurtant dring
A: Dendrimers are nano-sized, circular molecules with well-defined structure containing symmetric core ...
Q: Pregnant women exposed with contaminated environment. (a) possible abnormalities
A: you have asked multiple questions. According to our instructions we are allowed to answer only one. ...
Q: Starting with a single bacterial cell at time zero, assuming binary fission every 20 minutes, how ma...
A: Binary fission is a type of asexual reproduction typically observed in prokaryotes and a few single-...
Q: Which of the following is NOT true about bacterial endospores? a. They are produced by bacteria ...
A: Introduction: Bacterial endospore is the tough, dormant, non-reproductive structure produced by some...
Q: en gas, continuous air supply at air fl
A: Ejector circle reactors (ELR) are effectively utilized in modern compound cycles for gas/fluid respo...
Q: What determines a molecule’s solubility or lack of solubility inwater?
A: A molecules ability or inability to dissolve in water depends upon the presence of polar bonds and i...
Q: TRUE or FALSE Direction: Write T if the statement is TRUE and F if the statement is wrong. 1. There ...
A: Since we only answer up to 3 subparts, we'll answer the first 3. Please resubmit the question and sp...
Q: Outline the target organs and symptoms of the principal atopic diseases and their diagnosis and trea...
A: Atopic diseases (type of allergic response) involve the exaggerated response of the immune system fa...
Q: For question with blanks, choose the combination of answers that most accurately completes the state...
A: Immunity is referred to as the tendency of the immune system of the body to fight against any pathog...
Q: Differentiate between Parthenocarpy and Parthenogenesis. Give one example of each.
A: Parthenogenesis -- Parthenogenesis a type of asexual reproduction takes place in both asexual anim...
Q: Select the correct answer from the answers provided. The cross-linkage of antigens by antibodies is ...
A: Antibodies are the part of the adaptive immune system which is acquired only after infection with a ...
Q: Describe several applications of monoclonals in medicine.
A: A single white blood cell is cloned to make monoclonal antibodies. Following this method, all subseq...
Q: Cells contain built-in suicide genes to self-destruct by apoptosis under certain conditions. Can you...
A: The immune system protects the body from infections.
Q: a. Describe what could be summarized as the three Rs of immunity: recognize, react, remember. b. Why...
A: Since you have asked multiple questions , we will solve the first question for you. If you want any ...
Q: 3.4. About human skeletal muscle contraction, what are the correct statements? PHYSIOLOGY_basic (OJ...
A: Skeletal muscle contraction starts at the neuromuscular junction, which is the synapse between a mot...
Q: Northern Elephant Seals were hunted almost to the point of extinction in the 1800s. Although breedin...
A: Introduction : Natural Selection : Natural Selection Is The Process Through Which Individuals With V...
Q: Which part of the AK rules with the effector cell ? Select one . A. Fc region B .Sugar chains c. Hin...
A: In the immune system, effector cells are the relatively short-lived activated cells that defend the ...
Q: QUESTION 3 Which one of the following conditions would most likely allow gene frequencies to change ...
A: If the gene and allele frequencies in a particular population remain unchanged, then we can say that...
Q: Please make a Punnette Square then summarize its genotypic ratio and phenotypic ratio. Parent 1 ...
A: Answer : Let B = dominant gene b = recessive type. Parent 1= B1B1B2B2B3B3b4b4 Parent 2= b...
Q: D C
A: Chromosomes are entities that contain genetic information. Genetical information is required to surv...
Q: Explain how cells or organisms undergo mutation
A: In biology, the term which is used to define the fundamnetal smallest unit that can live on its own ...
Q: Quick question. So, A change in the generic composition of a population always means that adaptive e...
A: Introduction: Adaptive evolution refers to the changes in any organism's population which enable an ...
Q: The protons and neutrons are contained within the of the atom. Electron Cloud Atomic Center Middle N...
A: All matter is made up of tiny indivisible and indestructible раrtiсles called аtоms, according to Da...
Q: A bond linking two atoms of the same element through an equal sharing of electrons would be best def...
A: Introduction:- Nonpolar covalent bonds develop when two atoms of the same element or two elements th...
Q: Effect of covid-19 infection in cellular metabolism
A: Introduction Covid-19 Coronavirus disease 2019 (COVID-19) is a contagious disease caused by the cor...
Q: Predict the regions of low and high pH in the presence of oxygen in the mitochondria.
A: Answer of the question given below...
Q: Explain what would happen if a plant cell was placed in a hypotonic environment and why (be sure to ...
A: Hypotonic solution means that solution has lower solute concentration whereas hypertonic solution co...
Q: What is a body part
A: In order of thrive and function well, the organisms depends on their specialised body parts which in...
Q: Write a short note on the process of molecular mimicry.
A: Introduction: molecular mimicry is a phenomenon that has been just newly found as one of the several...
Q: On gene expression control what are the correct statements? MOLECULAR BIOLOGY basic Eubacteria c...
A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...
Q: Can u give me and overview/introduction about plants and it's parts
A: The main parts of plants are: Roots Shoot Leaves Flower
Q: What is the role of fossils in supporting the theory of evolution? hoon many fossils of intermediate...
A: Fossils are traces of animals, plants and organisms form past, they are important because they show ...
Q: When traders and missionaries fi rst went to the Hawaiian Islands, the natives there experienced sev...
A: In science, immunity is the capacity of multicellular creatures to oppose harmful microorganisms. Im...
Q: question 1 1- Is there a relationship between age and muscle gain? MUSCLLE PERCENTAGE AGE 2- Adjust ...
A: The contractile tissue grouped into coordinated systems is known as the muscles. On the basis of loc...
Q: What causes the abnormal signs indicative of a transfusion reaction?
A: The body fluid in humans and other animals that delivers necessary substances such as nutrients and ...
Q: Genes E, F, and D are linked in that order. The distance between D and E is 1 cM, and the distance b...
A: The F1 generation, in simple terms, is the first generation of offspring generated by a pair of pare...
Q: Contrast the primary and secondary response to antigens.
A: The immune system fight against disease-causing agents but as age increases the immune system get we...
Q: The primary route of carbon entry into the tetrahydrofolate (THF) pool is via the serine hydroxymeth...
A: Purine is a two-ring heterocyclic aromatic chemical. It's a substance that can be dissolved in water...
Q: Effect of covid-19 infection in cellular metabolism
A: Covid-19 is an orally available anti-viral medication used as a first line of defense against viral ...
Q: B. Arrange the following steps in the genetic engineering of corn to acquire pest resistance. to ind...
A: Genetic engineering is modification in the genetic makeups of the organism in order to get good afte...
Q: Suppose that the allele A for height is dominant, meaning that plants with genotypes AA and Aa are t...
A: Locus is the same position on homologous chromosomes, and alleles are genes on same locus. In a hete...
Q: PCR has revolutionalized biotechnology. Discuss three advantages and three disadvantages of PCR usag...
A: PCR or Polymerase Chain Reaction is the technique which is used for making many copies of a specific...
Q: Why does X inactivation occur in female mammals?
A: Causes of X inactivation: X-chromosome inactivation usually define through the term that they are be...
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version.
1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain
Step by step
Solved in 3 steps
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainA normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain geneYou start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?. If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located?
- You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globin