Answered: The algorithm or tool in MEGA that is…

The algorithm or tool in MEGA that is used for multiple sequence alignment of nucleotide/DNA sequences. ClustalX T-coffee MUSCLE O ClustalW

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 6SQ

See similar textbooks

Related questions

Q: What do you call this part of a phylogenetic tree pointed by the arrow that indicates divergence or…

A: Introduction:- Phylogenetic tree or evolutionary tree is a two dimensional graph which is used to…

Q: Glycogen synthesis and degradation are both activated when blood glucose levels increase. O True…

A: Glycogen is a multibranched polysaccharide of glucose that serves as a form of energy storage in…

Q: When we say that an individual organism has a greater fitness than another individual, we…

A: An ecological adaptation is any physical, psychological, or morphological characteristic of an…

Q: Location Reactants Products Production of Basis Frequency of Occurrence Organisms involved Chemical…

A: 1.Chloroplasts 2.mitochondria 3.CO2 4.water ; 5.glucose 6. 02 7 . Glucose 8. O2 9 . CO2 10. H2O…

Q: An inferential clustering method of phylogeny that considers probabilities of character state…

A: The study of evolutionary links between biological units, most frequently between species, or genes,…

Q: Joe is heterozygous for a dominant genetic disease. His wife, Jenny does not have the disease. They…

A: Hansbsb In order to establish that a marker is responsible for the disease, it must be present in…

Q: A genetic sequence database that contains annotated collection of all publicly available DNA…

A: There are a few databases that contains genetic DNA sequence information and are publicly available…

Q: LO11 Calculate the probability of genotypes and phenotypes in monohybrid crosses of sex linked…

A: Inheritance pattern is a phenomenon which determines how traits are passed on from parental…

Q: The image below is of a stained onion root tip. Determine the phase of mitosis that each cell below…

A: Mitosis is a cell division that forms two daughter cells. It includes prophase, metaphase, anaphase…

Q: how do the enzymes find these sequences? Does it have a specific domain that recognizes the…

A: The functions of central agents and the enzymes that catalyze chemical reactions at each stage must…

Q: The problem of replicating the lagging strand of DNA is solved through the use of Group of answer…

A: Okazaki fragments are fragments of DNA that are formed during the process of DNA replication. They…

Q: During photosynthesis, ATPS are produced by what process? A. photophosphorylation B. all of the…

A: Photosynthesis is the process of synthesis of glucose and oxygen by making use of carbon dioxide,…

Q: of.

A: All the above pictures are for the isolation of coliforms and intestinal bacteria. MacConkey agar…

Q: How do viruses replicate? What is the basic structure of viruses? What is the difference between DNA…

A: Microbiology: The examination of microscopic creatures' which includes viruses, bacterium, algae,…

Q: a. Compare the ancient prokaryotes, their environment and metabolism, with the prokaryotes that…

A: Prokaryotes are small and single-celled organisms. They are very simple in structure. For e.g.,…

Q: Suppose researchers studied the first chromosome of a new species and mapped three genes of…

A: The location of the genes on chromosomes is dependent on crossing over. The genes are linearly…

Q: In a hypothetical species of mice, the shaggy gene determines hair length. S is the dominant allele…

A: Hardy-Weinberg Equilibrium is a notion that scientists use to examine gene evolution in a certain…

Q: For hemophylia A , the gene involved is (gene 8 ) is a X chromosome), what effects of this altered…

A: Genetic alterations (mutations) in the F8 gene lead to haemophilia A. In biology, a mutation isan…

Q: Microevolution is defined as all the answers are correct evolutionary changes on a grand scale…

A: Introduction Microevolution can be defined as the evolutionary changes that occur within the species…

Q: Label the layers of the skin.

A: The correctly labelled diagram is shown in step 2.

Q: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…

A: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…

Q: Briefly explain antigenic drift and antigen shift. Which is usually more dangerous of the two and…

A: Antigens are foreign substances that induce the body's immune system to generate an immune response…

Q: Does Spallanzani experiment prove or disprove the spontaneous generation of idea of emergence of…

A: An antiquated scientific idea known as the spontaneous generation theory claimed that live things…

Q: Mutation on hemophilia a

A: Hemophilia A is most often a genetic disorder. This means that it’s caused by changes (mutations) to…

Q: Using the glyoxylate cycle, a germinating plant can convert two molecules of acetyl CoA into one…

A: Biological membranes are divided into specific functional areas with distinct compositions that can…

Q: Section II: Dihybrid Crosses Based on the information below, give all the possible genotypes that…

A: The term independent assortment of chromosomes refers to the fact that when a "gamete is generated…

Q: definition of global warming what are the factors that cause global warming Consequences of global…

A: With the increase in harmful chemicals in the Earth’s atmosphere, there has been an increase in the…

Q: Which of the following statements best describes the synthesis of secreted proteins? a.) Secreted…

A: Secreted proteins are those proteins that gets secreted out of the cell.

Q: Use Beer Lamberts law to calculate the concentration of oxidised DCPIP A= 600 L = 1cm K = 11800 M^-1

A: The amount of light absorbed is related to the concentration of the substance absorbing it according…

Q: It is the least reliable method of contraception: intrauterine device condom diaphragm rhythm method…

A: Ans - D) Rhythm Method The rhythm method refers to tracking the ovulation or menstrual cycle of the…

Q: Which of the following is true regarding the difference between graded and action potentials? a.)…

A: Action potentials activate neural circuits, which can either promote or inhibit particular bodily…

Q: Some individuals are immune-compromised because their bodies do not make enough T-cells. What is the…

A: T cells are a type of lymphocytes, which help the body fight against infections along with other…

Q: LO19 Identify the evolutionary relationships between Archaea, Bacteria and Eukarya. Which of the…

A: Introduction : The three basic domains of life in nature are archaea, bacteria, and eukarya.…

Q: An outgrowth of nervous tissue from the hypothalamus forms which endocrine structure? A. Anterior…

A: The hypothalamus is a part of the brain located at the base of the brain. It controls many important…

Q: A clustering algorithm that requires the knowledge of the distance between species or taxa to create…

A: A branching diagram or tree illustrating the evolutionary relationships among distinct biological…

Q: Using an outside souce, find out how glucose moves into a human skeletal muscle cell.

A: Glucose is primarily transported into muscle cells by a carrier-mediated system made up of protein…

Q: You are working with two different yeast cultures to study their genetics. But, you are not sure…

A: Saccharomyces cerevisiae, a yeast species, mates when two haploid cells of opposing mating types…

Q: Correctly label the following functional regions of the cerebral cortex.

A: The correct labelling of the functional regions of brain is given in step 2.

Q: 16. When a nucleophile attacks the ß phosphorous atom of ATP, what kind of transfer occurs? A. B. C.…

A: A phosphoryl group is transferred from a molecule that is the donor in a phosphoryl transfer…

Q: 22. State how many children or percent that can be normal pigmented with dwarfism (A_D_). 23. State…

A: Autosomal inheritance means the inheritance or passing of the genetic trait from parents to…

Q: What are the difference between Type 1 and Type 2 diabetes mellitus

A: Diabetes is a disease that occurs when the blood sugar level gets high due to less secretion of…

Q: Match the below with the correct descriptions Proteins that hold together two sister chromatids…

A: INTRODUCTION Answers to the match the following is given below.

Q: Although the genetic code is universal, a few organisms such as Paramecium have a slightly modified…

A: Translation is the last step of gene expression. In this protein, is synthesized with the help of…

Q: - Which bags lost mass? Which molecule directly caused the decrease in mass? Describe what direction…

A: Osmosis is a passive process that doesn't require any energy to function. It entails the migration…

Q: Define the term conjunctivitis and give two examples of what can cause it.

A: Introduction:- Sensory organs are those organs that can sense and detect the change in external…

Q: 2. According to the phylogenetic tree, which of your fishes are most closely related to each other?…

A: Seawater is denser than freshwater, marine fish have smaller swim bladders than freshwater fish. The…

Q: 28. Determine if the trait above is dominant or recessive. Explain your answer using specific people…

A: A pedigree chart is similar to a family tree where it discusses the inheritance of a trait over…

Q: For separating DNA of different sizes, you would use PCR Gel electrophoresis Restriction enzymes О…

A: Macromolecules are generally separated on the basis of their charge, binding affinity and size using…

Q: Label the cell types found in the skin.

Q: Which of the following best describes the pH of the endosomal interior?

A: Endocytosis is a term coined by Christian deDuve in the year 1963. Endocytosis is the process by…

Question

The algorithm or tool in MEGA that is used for multiple sequence alignment of nucleotide/DNA sequences.
ClustalX
T-coffee
MUSCLE
Clustal W

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA Profiles as Tools for Identification A PCR-based paternity test is conducted using STRs that consistently produce a unique DNA fragment pattern from a single chromosome. Examining the results of the following Southern blot, which male(s) can be excluded as the father of the child? Which male(s) could be the father of the child?
generated after a cDNA library is made unique sequences in the genome useful for mapping using sequence information all of the above
Which of these is not a tool for comparing DNA sequences? BLAST Fasta PLINK A dotplot e.g. dotlet
What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceTool Best Local Alignment Search Tool Best Local Algorithm Search Tool
schematic diagram for the procedure in doing DNA extraction, isolation and quantification
Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
How we prepared the sample of DNA and what kinds of tracking dye we add to sample in SDS-PAGE ? Please mention the source of the information. write the resources, any single resource
You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.
The following data shows bisulfite sequencing results for a small region of the genome. How many methylated C's are in the gene? Reference sequence: GAGACCTCG Bisulfite sequencing: GAGACCTTG
Transcribe and translate the DNA strand Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
DNA ladder is attached (the picture shows HindIII as H, EcoRI as E, BamHI as B). Now, determine the size of fragments created by EcoRI and BamHI. In the graph attached there is the fragment size of HindIII. HindIII EcoRI BamHI Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) 23455 11985 7430 4375 2150 1850
Which one of the following options would be a good way to identify the location of the poly A tail in the published DNA sequence for a gene? Look for AATAAA near the 3’ UTR of the DNA sequence. Look for TTTTTTTTTTTTTT… (many Ts) near the 3’ UTR of the DNA sequence. Look for AAAAAAAAAAA… (many As) near the 3’ UTR of the DNA sequence. Look for a stop codon.