The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand.Step 2In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help) 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this geneby PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify thisgene?АTGTTTGTTTTТСTTGTTTTATTGCCACTAGTCTСТAGTCAGTGTGTTAATCTTACAАССAGAACTCAАТТАСССССТGСАТАСАСТААТСTTTCАCАCGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAAO A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAAO B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGACO C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAAO D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGAC

Name: The answer is option A In the PCR amplification, two primers are used
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the

The polymerase chain reaction (PCR), is a key method in molecular biology for amplifying a…

Science

Biology

The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)

The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked with designing 2 primers to clone this gene by PCR amplification. What are the sequences of the two 21bp primers in the 5' to 3' orientation that will allow you successfully amplify this gene? АTGTTTGTTTTТСTTGTTTTATTGCCACTAGTCTСТAGTCAGTGTGTTAATCTTACAАССAGAACTCAАТТАСССССТGСАТАСАСТААТСTTTCАCАC GACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAA O A) ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA O B) TAAAACAAGAAAAACAAACAT and TTATGTGTAATGTAATTTGAC O C) ATGTTACTTGGTGACCAGTTG and GTCAAATTACATTACACATAA O D) ATGTTTGTTTTTCTTGTTTTA and TTATGTGTAATGTAATTTGAC
You receive purified mRNA that codes for the spike protein of SARS-CoV-2 as well as plasmid pET32(a+). Explain how you will prepare SARS-CoV-2 spike cDNA and name the enzymes that you will need how you will clone the cDNA into pET32(a+) and select the recombinant plasmid how you will then produce a recombinant SARS-CoV-2 spike and purify it
a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer present
The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product which is cloned into a 1.5 kb plasmid for bacterial expression. What would the agarose gel look like, including a lane for markers, and where would the following pieces of DNA run: 1. the PCR insert 2. the empty uncut plasmid 3. the empty plasmid cut with a single restriction enzyme 4. the cloned plasmid containing the insert
A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
4a2)The xyz gene product, encoded by a new viral strain, has corresponding humanhomologs. Blast analyses revealed various human viral-related gene products of874 amino acids residues. Using the default matrix in BlastP program to performa pairwise sequence alignment between xyz gene product and its correspondinghuman homolog, the following data was obtained: What would be the effect of changing the scoring matrix from the defaultmatrix to PAM30? Replicate the above table and indicate whether the score,E value, identity and positive values will increase, decrease or remains thesame as the values given in the table above. Justify your answers.
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
1) You wish to make a restriction map of a 17.0 kb linear fragment. You digest the fragment with Sbf1, Pst1, and a mixture of Sbf1 and Pst1. From these results, you obtain these fragments following agarose gel electrophoresis of the three samples: Sbf1: 7kb and 10kb Pstl: 3kb, 6kb and 8kb Sbf1 and Pstl: 1kb, 2kb, 6kb and 8kb Question: In which of the Pstl fragments is the Sbfl site located? 8kb O 6kb 3kb O None of the above
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to amplify the following gene by PCR. GTAGAATATG ATAAGCGAAA CTGCAAATCG CGTTTGGGGC GATACAAGTA GTGTACGCGG ACCGCGCCGA GCGGGCTATG GTTTCTCCAC TATCAGTTCT TCTCCTGTCC CAGCGAAGTC GAGGTCCAGC CCTACGGTAC ATAACTAACA CGGTTTGAAG AAGATACGAT CTTACGAAGT AAAGAAAATT TGTAGTCAGC CCGGTTCGCT TGTGTCCAGC TAATCGATTG ATTGGCCCCA GCAGGCGAGA TGAACATAGT CATGCGCTGT CTAATAGCCC ATTTGACGTG TAGGTGGCGC TTTTATTTCT GAGGTGGAAA T a) If the primers were both 20 nucleotides long, what are the sequences for both PCR primers that will amplify only the highlighted region? Be sure to label the 5' and 3' ends. (4 points) b) What is the length (in bp) of the entire region amplified by their primers (i.e. the amplicon length)? (Note: the spacing in the above sequence is intentionally uniform) (2 points) c) If you start with 300 copies template DNA how many copies would you expect to produce if you ran the PCR for 22 cycles? Show your work.…
Genomic DNA from a family where sickle-cell disease is known to be hereditary, is digested with the restriction enzyme MstII and run in a Southern Blot. The blot is hybridised with two different 0.6 kb probes, both probes (indicated in red in the diagram below) are specific for the β-globin gene (indicated as grey arrow on the diagram below). The normal wild-type βA allele contains an MstII restriction site indicated with the asterisk (*) in the diagram below; in the mutated sickle-cell βS allele this restriction site has been lost. What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an individual with sickle cell disease (have 2 βS alleles)? Probe 1 Probe 2 (a) 0.6kb 0.6kb and 1.2kb (b) 0.6kb and 1.8kb 0.6kb, 1.2kb and 1.8kb (c) 1.2kb 0.6kb (d) 1.8kb 1.8kb a. (a) b. (b) c. (c) d. (d)
You inserted your gene of interest in pBR322 as illustrated below. You spliced the vector and insert using BamHI. After ligation and transformation, describe your screening procedures. Scal 3844 Pvul 3733 Pstl 3607 Vspl 3537 Eco311 3433 Eam11051 3361 Cail 2884. rep (pMB1) bla (Ap) 3293 Bsul5l 23 EcoRI, Xapl 4359, Hindi 29 Eco321 185 Aatil 4284, Sspl 4168 3133 Afill, Pscl 2473 2519 Lgul 2350/ 4153 pBR322 4361 bp Ndel 2295/ Bst11071 2244/ 2106 1915 Bspol, Nhel 229 rop Pull 2064 Pfol 2117 Esp31 2122 Ppu211 2225 Psyl 2217 BamHI 375 Tstl 389 SgrAl 409 tet (Tc) 1276 Pael 562 Xagl 622 Sall 651 Boxl 712 Eco521 939 Bsp681 972 Bvel 1063 Mva12691 1353 Eco1301 1309 Eco881 1425 Misl 1444 Bpu101 1580 Bsgl 1650 Kpn21 1664 BseJl 1668