12 The cells shown in the image are from a rare species of plant and illustrate different stages of mitosis or meiosis.Determine the diploid number of chromosomes (2n) in this species of plant.diploid number of chromosomes:Match each cell to the specific stage of meiosis or mitosis, the number of chromosomes, and the number of DNA moleculesper cell.StageChromosomesDNA molecules88Question Source: Pierce 6e - Genetics: A Conceptual Approach | Publisher: W

Cell division is an important process that helps to keep the cells growing in number. This enables…

The cells shown in the image are from a rare species of plant and illustrate different stages of mitosis or meiosis. diploid number of chromosomes: Determine the diploid number of chromosomes (2n) in this species of plant. Stage UV V V V V Match each cell to the specific stage of meiosis or mitosis, the number of chromosomes, and the number of DNA molecules per cell. Chromosomes 000000 DNA molecules

The cells shown in the image are from a rare species of plant and illustrate different stages of mitosis or meiosis. diploid number of chromosomes: Determine the diploid number of chromosomes (2n) in this species of plant. Stage UV V V V V Match each cell to the specific stage of meiosis or mitosis, the number of chromosomes, and the number of DNA molecules per cell. Chromosomes 000000 DNA molecules

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 3QP: A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13....

See similar textbooks

Similar questions

Variations in Chromosome NumberAneuploidy Describe the process of nondisjunction and explain when it takes place during cell division.
If we call the amount of DNA per genome “x,” name asituation or situations in diploid organisms in which theamount of DNA per cell isa. xb. 2xc. 4x
A cell has two pairs of submetacentric chromosomes, which we will call chromosomes Ia, Ib, IIa, and IIb (chromosomes Ia and Ib are homologs, and chromosomes IIa and IIb are homologs). Allele M is located on the long arm of chromosome Ia, and allele m is located at the same position on chromosome Ib. Allele P is located on the short arm of chromosome Ia, and allele p is located at the same position on chromosome Ib. Allele R is located on chromosome IIa and allele r is located at the same position on chromosome IIb.a. Draw these chromosomes, identifying genes M, m, P, p, R, and r, as they might appear in metaphase I of meiosis. Assume that there is no crossing over.b. Taking into consideration the random separation of chromosomes in anaphase I, draw the chromosomes (with genes identified) present in all possible types of gametes that might result from this cell’s undergoing meiosis. Assume that there is no crossing over.
A couple attends a medical consultation for infertility problems and repetitive abortions. The doctor suspects that the problem is due to a mutation, that is why he requires a study in which chromosomes can be visualized, and which reflects if there are any alterations in structure and number. What procedure could he use to obtain this information? Group of answer choices Hydrolysis Locus Karyotype In vitro fertilization The upper extremities of the whale, the bat, the cat, the horse and the man, fulfill in some the function of fins to swim, in others the function of wings to fly, and legs or arms in the case of the man, but all of them maintain the same structure with the same number of bones. This allows us to identify a common ancestor in these groups. What evidence of evolution does the example refer to? Group of answer choices Vestigial organs Converging characteristics Homologous organs Analogous organs Both tubers and potatoes contain a large amount of starch,…
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
The size of one copy of the human genome is approximately 3 billion base pairs, and it contains about27,000 genes organized into 23 chromosomes.a. Human chromosomes vary in size. What wouldyou predict is the size of the average chromosome?b. Assuming that genes are spread evenly amongchromosomes, how many genes does an averagehuman chromosome contain?c. About half of the DNA in chromosomes containsgenes. How large (in base pairs) is an averagehuman gene?
The four chromosomes depicted here are Y chromosomes from men in different parts of the world. The light purple bands represent specific genesthat are identical in all four men. The red bands represent genetic mutations (M) that appeared at different times; M168 appeared about 50,000 years ago, M9 about 40,000 years ago, and M3 about 10,000 years ago. Based on whatyou have learned in this chapter, identify the geographic source of men carrying each of these chromosomes: African, Eurasian, Amerindian, and first migrants out of Africa.
In which stage(s) of the cell cycle, mitosis or meiosis do each of these processes occur (multiple stages apply to some) Crossing-over: Chromosome supercoiling: Separation of sister chromatids: DNA synthesis: Chromosome reduction from 2N to N: 4. A previously undiscovered single celled organism was found living at a great depth on the ocean floor. Its nucleus contains only a single, linear chromosome consisting of 7x10^6 nucleotide pairs of DNA coalesced with three types of histone-like proteins. The analysis of individual nucleosomes revealed that each unit contained one copy of each protein and that the short linker DNA had no protein bound to it If the entire chromosome consists of nucleosomes (discounting any linker DNA), how many are there and how many total proteins are needed to form them?
Why do eukaryotic cells need to go through the elaborate procedure of mitosis rather than simply dividing during interphase? Select as many answers as apply. 1.Daughter cells must be genetically identical to the mother cell, for homeostasis and ordered tissue growth. 2.Bivalent chromosomes must condense and be separated in an orderly fashion, to allow equal distribution of copies into daughter cells 3.Physically dividing the nucleus during interphase would likely lead to gross chromosome breakage and highly unequal assortment of genetic information into daughter cells. 4.Dividing the nucleus during interphase would have the same outcome as mitosis 5.Daughter cells must have half the number of chromosomes after mitosis than the mother cells 6.The homologous pairs of chromosomes need to be separated, to ensure copies go to the daughter cells.
Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on the chromosome and homologous pair; the centromere and sister chromatids. In each of these drawings explain how many and where are the Watson and Crick double strand DNA molecules. 2.Diagram of the cell cycle (not cell division) for an organism with two chromosomes (n=2, 2n=4). Include; interphase (including the G1, S, G2 phases), mitosis and cell cycle checkpoints. 3.For an organism with 4 chromosomes draw: a. Metaphase of Mitosis, b. Metaphase of meiosis I, Metaphase of meiosis II.
For each of the terms in the left column, choose thebest matching phrase in the right column.a. reciprocal translocation 1. lacking one or morechromosomes or having oneor more extra chromosomesb. gynandromorph 2. movement of short DNAelementsc. pericentric 3. having more than two completesets of chromosomesd. paracentric 4. exact exchange of parts of twononhomologous chromosomese. euploids 5. excluding the centromeref. polyploidy 6. including the centromereg. transposition 7. having complete sets ofchromosomesh. aneuploids 8. mosaic combination of maleand female tissue
What is a genome? Describe the following terms/structures as they pertain to a eukaryotic genome: diploid, haploid, gamete, homologous chromosomes, locus, and genes