Answered: THE COARSE (VISIBLE) DUS 1. a long time…

THE COARSE (VISIBLE) DUS 1. a long time is in the air 2. quickly settles 3. Deeply penetrates into the lungs 4. exerts a toxic effect

An Illustrated Guide To Vet Med Term

4th Edition

ISBN:9781305465763

Author:ROMICH

Publisher:ROMICH

Chapter1: Ready, Set, Go

Section: Chapter Questions

Problem 3MC

See similar textbooks

Related questions

Q: Which of the following individuals would most benefit from a low sodiun O a. Joey is a 5 year old…

A: The World Health Organization recommends that adults decrease their sodium intake to decrease their…

Q: Forms clots to prevent blood loss Transports substances to and from capillaries Assists in the…

A: oxygen and nourishment to the lungs and other areasTo avoid excessive blood loss, blood clots are…

Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?

A: The gene products of the lac operon are very important for lactose metabolism. This is crucial for…

Q: at is trinocular microscope

A: A magnifier could be a device that magnifies a picture of a little object, revealing details that…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: You are walking to class, pondering the intricacies of physiology, when you trip over an uneven…

A: The largest part of the brain is cerebrum. It is divided into two hemispheres, or halves, called the…

Q: This question follows from the last question The D value for a resistant strain of bacterial spores…

A: There are general points that should be kept in mind : as we know that bacterial growth is an…

Q: The earliest discrete embryonic structure from which the entire nervous system eventually develops…

A: Q. The earliest discrete embryonic structure from which the entire nervous system eventually…

Q: A plant that grows very close to the ground, tends to be small in size, favors moist environments…

A: Given: Plants are the primary source of nutrients for all living organisms. Plants take sunlight for…

Q: What physical activity that can change the gas concentration and how to restore and maintain to…

A: Human body maintains the homeostasis in many ways. This homeostasis of gases can be maintained by…

Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…

A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…

Q: During aerobic respiration, high energy electrons are taken from glucose and transferred to electron…

A: Cellular respiration takes place either aerobically or anaerobically inside the cells. In case of…

Q: differentiate a nodule from a root gall? (

Q: We run the HinDIII-digest of lambda-DNA as the standard ladder on the gel. Number the largest…

A: Lambda-DNA The lambda DNA is approximately 48502 base pairs in length. It can be cleaved by 12…

Q: Below is a table that shows the changes in a population of domesticated rabbits. What is the most…

A: The rate of population expansion decreases and ultimately ceases as resources are depleted: this is…

Q: What types of evidence support the hypothesis that land plants descended from the group of green…

Q: Which of the following cells secretes the enzymes - gastric lipase and pepsin ogen? Group of answer…

A: Mucous neck cells: These basically located in gastric glands. These contain less mucin in apical…

Q: i need the answer quickly

A: Dust is of following types: - Visible Microscopic Ultra Microscopic Visible is filtered out at the…

Q: All of the following are examples of producers EXCEPT: - Polytrichium commune, hair cap moss -…

A: Plant are the photosynthetic autotrophic organism which have ability to make their own food . It…

Q: Histone proteins are among the most highly conserved proteins in eukaryotes. histone h4 proteins…

A: Proteins are large, complicated molecules that perform numerous functions in the human body. Protein…

Q: 10 13 2 16 CERVICAL (coudal view)

A: There is one cervical vertebra present in frog (the atlas is the only cervical vertebra in the frog.…

Q: To explain: How a compound can be perceived as both sweet and bitter.

A: Taste receptor cells mediate taste sensations and preferences. Taste receptors are chemoreceptors…

Q: With the exception of olfaction, all sensory pathways first travel to the ________, which acts as a…

A: Introduction :- The thalamus is a diencephalon structure that is primarily grey matter and plays…

Q: Learning Task 13-1: Diseases Caused by Mutations Disease What gene is affected by Mutation? What is…

A: A genetic disorder is a medical condition caused by one or more genetic defects. A chromosomal…

Q: During DNA replication, the function of RNA primers is to O serve as a binding site for DNA ligase…

A: Primer is a short sequence that is synthesized by primase (a type of RNA polymerase) enzyme before…

Q: Write a detailed not on Utilization of grasses in pasture) and don't copy paste from Google plz

A: The grasses also called as the graminoids are monocotyledonous plants belonging to the family…

Q: Venous System a. How does the blood in the pulmonary vein differ from that in other veins? b. Name…

A: All vertebrates' circulatory systems are dominated by veins and arteries. With each heartbeat, they…

Q: How do the skin, gastrointestinal tract, and respiratory system provide defenses against invading…

A: INTRODUCTION The body's most fundamental kind of nonspecific defence is physical defence. Physical…

Q: Indicate the average direction of change (increase, decrease, or no change) observed between 1850…

A: When there is long term change or shift in temperature or weather patterns , then it is called as…

Q: METHOD FOR OBJECTIVE EVALUATION OF NATURAL LIGHT 1. the angle of incidence 2. the opening angle 3.…

A: Natural Light: Sunlight is a subset of the Sun's electromagnetic energy, which includes infrared,…

Q: Which of the following are functions of the skeletal system? (select all that apply) a) mineral…

A: Introduction Skeletal System:- It is the foundation of your body, giving it structure and allowing…

Q: Set 3: Mutagens _51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…

A: Introduction :- Ultraviolet light is a type of electromagnetic radiation that causes black-light…

Q: Propose specific types of mutations in the gene forthe regulatory subunit of cyclic-AMP-dependent…

A: PKA is a protein kinase that is activated by the second messenger cyclic AMP (cAMP). It regulates…

Q: Secretors (genotypes SS and Ss) secrete their A and B blood group antigens into their saliva and…

A: Given: Secretors (genotypes SS and Ss) secrete their A and B blood group antigens into their saliva…

Q: 22 Complete the following statements to describe how to malntaln a balance between energy input and…

A: Answer

Q: Which characteristic do all prokaryotic and eukaryotic cells share? They contain a nucleus. They…

A: Prokaryotes are single-celled microscopic organisms that are divided into two distinct groups: the…

Q: ROOM FOR VISITORS PHARMACIES - BACTERICIDAL LAMPS, SHIELDED, BECAUSE 1. air in the trading floor has…

A: 1. Air in the trading floor is highly contaminated Indoor health care is important it significantly…

Q: Describe the three phases of transcription. Be specific for full credit.

A: Transcription is completed in to three states... 1. Initiation of RNA chain formation 2. Elongation…

Q: Compare the stem of a monocot, dicot, and woody dicot: Feature Monocot Herbaceous dicot Young woody…

A: Features monocot dicot Cortex present but not differentiated present and differentiated…

Q: In which of the following does nitrogenous base pairing (base complementarity via hydrogen bonds)…

A: Nitrogenous base pairing can include DNA-DNA, DNA-RNA, RNA-RNA pairing. Both DNA and RNA are made up…

Q: Suppose that the circulating concentration of hor-mone is 10–10 M and the Kd for binding to its…

A: To function properly, the body generally knows that they are supposed to require coordination…

Q: The membrane structure that eventually evolved into the double nuclear membrane of the eukaryotes…

A: Prokaryotes are the primitive type of the cell that lack a proper membrane, whereas eukaryotes are…

Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…

A: Introduction :- Cytosine, along with adenine, guanine, and thymine, is one of the four nucleobases…

Q: Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is…

Q: The greatest SINGLE threat to most species of plants and animals is: Question 17 options: -…

A: Day by day, environmental pollution and anthropogenic activities degrade the natural resources that…

Q: Important disturbances that change alter the sequence of ecological succession include all of the…

A: Ecological succession Process with which the organisation of a biological community evolves over…

Q: Patients who are taking herbal remedies or dietary supplements do not need to list them on…

A: False...

Q: PART OF THE SOLAR SPECTRUM PROVIDING BACTERICIDAL ACTION 1. visible light 2. infrared rays 3.…

A: A bactericide, commonly known as a bacteriocide or Bcidal, is a chemical that destroys bacteria.…

Q: To explain: Why the patients with severe liver disease often have impaired blood clotting.

A: The liver, one of the major organs in the human body, is in charge of fat metabolism. It also plays…

Q: 16. Identify each event found below as a homeostatic response or not a homeostatic response.…

Question

i need the answer quickly

THE COARSE (VISIBLE) DUST
1. a long time is in the air
2. quickly settles
3. Deeply penetrates into the lungs
4. exerts a toxic effect

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Could other inmates develop botulism from being in contact with theill prisoners?a. Yes, it can be spread in body fluids.b. No, a person must ingest the toxin. c. Yes, it can be carried by inanimate objects.d. No, C. botulinum bacteria cannot grow in human tissue.
What food should you avoid feeding a child under 1 year old because of potential botulism? a. honey b. milk c. apple juice d. applesauce
Microbiology help needed ASAP!! thanks Damage to the tooth structure (caries) is primarily caused by an oral bacterium’s ability to: A. attach to the gums. B. metabolize/ferment fructose to lactic acid. C. convert proteins to sugars. D. invade plaque and dissolve the gums.
I only need the row 3 which is "Taenia Solium".
arks: 1 Frankincense should be avoided if you have: Choose one answer. a. cancer b. blood clotting problems c. acne d. dental issues
Ciprodex Otic#7.5 mL4 gtts AU bid x 7 days The physician then tells the patient to continue using it after the 7 days are up until it is all gone.What should be the estimated days supply for this ear drop? [____] days
Tell me three things that you know about controlling microbial growth - think about how you handle certain foods in you home. Why is it so important to learn about how we can control microbes?
1. missing a name or two from the list (Enterobacter aerogenes), and (Serratia rubidaea)- should be 20 2. Proteus Vulgaris (spelling) is eliminated under citrate so you can't have it at the end. 3. Which test MR or VP - not both
Food Irradiation – Know the facts in Canada Canadian sources only (please no U.S. as regulations are different). Answer in your own words and cite the sources you used. Thank you! 1. What is food irradiation and how is it done? 2. Does Health Canada have a role in the irradiation of food? If so, please explain. 3. When used as approved, what four effects does irradiation have on food? 4. What are some foodborne illness-causing microorganisms that can be controlled through irradiation? 5. Explain how gamma rays are used to irradiate food.
True or false: you should always blow on your inoculation loop after hearing in the flame in order to cool it so you don’t kill your specimen I truly feel like this is false because but I’m second guessing myself
5. This type of fog is produced from warm and moist air blowing over a cold surface: Steam fog Radiation fog Advection fog Upslope fog None of the above
Tell me 3 things about each one? are they selective , differential , positive , negative results etc. TSI TUBES UREA BROTH