During DNA replication, the function of RNA primers is to O serve as a binding site for DNA ligase open replication bubbles O serve as starting points for DNA strand elongation by DNA polymerase I in the 3' - 5' direction serve as starting points for DNA strand elongation by DNA polymerase IIl in

During DNA replication, the function of RNA primers is to O serve as a binding site for DNA ligase open replication bubbles O serve as starting points for DNA strand elongation by DNA polymerase I in the 3' - 5' direction serve as starting points for DNA strand elongation by DNA polymerase IIl in

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 11SQ: Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from...

See similar textbooks

Related questions

Q: define mutator genes and explain their role in carcinogenesis

A: Carcinogenesis is a multistage and multistep process involving modification and mutation to genes…

Q: salient features of guidelines on the disposition of confiscated wildlife species in the Philippines

A: Wildlife species are the animals that are undomesticated and live in an area where they arrive…

Q: What would be the consequences for eukaryotes if all prokaryotessuddenly became extinct?

A: Prokaryotes play an important and indispensable role in our ecology and hence sudden disappearance…

Q: Choose an organism (plant or animal) and write its common name on the line below. Write the…

A: The earth's biosphere consists of many animals and plants and studying them individually is a…

Q: Match the viruses with the diseases that they cause: Human Immunodeficiency virus Herpes zoster H1N1…

A: Viruses are the connecting link between the living and the non living. These have some properties of…

Q: Make a situation on how an organism (plant/animal) maintains homeostasis.

A: Homeostasis It is defined as the ability of the organism to maintain a constant and stable internal…

Q: The giant axon of the squid (Figure Q11–3) occu-pies a unique position in the history of our…

A: The Nernst equation for univalent ions at 20 degree celsius is : V=58mV x log c0/ci in which c0 is…

Q: What are the physical and physiological differences between an artery and a vein?

A: Artery- The blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body.…

Q: What term describes the substance that is bound by an enzyme and converted to product? O a. Coenzyme…

Q: Section E. The Secondary Tissues of Roots in Woody Dicots Identify and label these parts in old…

A: Roots that are still growing are called young roots. The phellem, the periderm's outermost layer, is…

Q: Below is a Figure of an Onion Root Tip, determine which of the encircled is/are meristematic?

A: Among the encircled regions the region 1 is representing the root apical meristem.

Q: Pathopysiology for imperforated anus

A: Introduction Pathophysiology:- It is a deranged function in an individual or an organ due to…

Q: Derive an explanation of a human genetic disorder.

A: A genetic disorder the kind of disorder that is due to the mutation in a single gene. Mutations are…

Q: Compare and contrast GPCR and RTK signaling. What role does GTP play in each? What role does…

A: Receptors are composed of proteins. These involve in cell signaling process.Two types of receptors…

Q: What do you mean by protandry? Give its advantages?

A: Introduction - When a creature begins its life as a man and later transforms into a female. The…

Q: 4. Write short notes on Ribosome.

A: Introduction - The site of protein synthesis in the cell is the ribosome, which is an intercellular…

Q: For fusion of a vesicle with its target membrane tooccur, the membranes have to be brought to within…

A: Proteins are well known to define that they are used as large, complex molecules that perform…

Q: Using the following list, describe the proper sequence for the events of animal development: 1.…

A: Animal development is occurs in sequential manner.

Q: To examine: Whether the statement "All flowers are pollinated by bees" is true or false.

A: A flower is the reproductive part of an angiosperm plant's modified thick shoot. The transfer of…

Q: Not yet answered Protein X and Y are mixed together. Protein X is 400 residues in size, and…

A: Chromatography It is a laboratory technique through which a mixture is separated into its…

Q: What is Ponceau S and why do we use it during western blotting?

Q: Why do anisogamous organisms only experience the twofold cost of sex?

A: Anisogamy Aniosgamy is a reporduction process in which the different forms or sizes of male and…

Q: Question 44 1 pts Reactants capable of interacting to form products in a chemical reaction must…

A: Activation energy is defined as the minimum amount of extra energy required by a reacting molecule…

Q: Explain what is meant by the statement "Metabotropic receptors act via second messengers."

A: Metabotropic receptors: Metabotropic receptors is also known as G-protein coupled receptor that…

Q: When there is light, plants release oxygen. What else may plants also use oxygen in? photosynthesis…

A: Plants release oxygen from photosynthesis. Photosynthesis is a process in which green plants prepare…

Q: Trace the paths that water and mineral ions travel as they movefrom soil into a root’s vascular…

A: The underground branching root systems of plants are frequently larger than the aerial component of…

Q: Livestock Breed Identific - Student Notes 46. Piedmontese Size: breed Cows average between 1.200 to…

A: The Piedmontese is a breed of domestic cattle, originated in north west Italy in the region of…

Q: In the beginning of the Surgery section, what is the “general” section? Do we use modifiers in the…

A: General surgery is a surgical speciality that focuses on abdominal contents such as the oesophagus,…

Q: Why do systems of classification keep on changing? Do you see this as good or bad? Why do you say…

A: Introduction Classification system:- The classification system is the establishment of a…

Q: How are the alleles of a gene different from each other? What is its importance?

A: Alleles are different variants of the same gene that are genetically different . For example, a gene…

Q: A child with Type O blood is born to a mother with Type A blood. What is the genotype of the…

A: 2)Given, Phenotype of mother is A blood group. Phenotype of child is O blood group. As the child is…

Q: 14. Why is titin important with respect to muscle contraction?

A: Titin is a protein encoded by a TTN gene. It is the largest protein in human beings.

Q: Summarize the basic features of excavates and distinguish among diplomonads, parabasilids, and…

A: Protists are unicellular eukaryotic organisms.

Q: Explain why are B cells known as Antigen Presenting cells and what happens after antigen…

A: As B cell has MHC class II so that it can present antigen. B celk has IgM or IgD antibody that…

Q: Distinguish between a fibrous root system and a taproot system

A: The vascular tissues of plants, which are composed of specialized conducting tissues, xylem and…

Q: Leaves typically have high surface area to volume ratios to maximize the rate of photosynthesis.…

A: Xerophytes have lower or less surface area of leaves than other plants. This adaptation is due…

Q: Identify the true statement(s) about global temperatures across Earth's history. (Note: may or may…

A: Given: Global temperature burden is increasing constantly around the globe. Earth's history has…

Q: What role does cholesterol play in the plasma membrane? Select the best answer. O It provides a…

A: Cholesterol's significance in bilayer and monolayer lipid membranes has piqued researchers'…

Q: Explain the monocarpic fruits with example.

A: There are two types of plants based on their different types of flowers that show their life cycle…

Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…

A: Introduction DNA:- is the hereditary material of an organism. The gene comprises the DNA. The…

Q: How would DCMU affect formation of ATP? Of NADPH? Explain.

A: DCMU is a very specific and sensitive inhibitor of photosynthesis. It blocks the QB plastoquinone…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: Water molds reproduce asexually by forming _______________ and sexually by forming _______________.…

A: Introduction :- Oomycetes (a term for creatures in the phylum Oomycota) are a fungus-like group of…

Q: phenotypic screens.

A: Phenotype: Any measurable characteristic or distinctive trait possessed by an organism is called The…

Q: How does the immune response of the human body differ from a bacterial infection vs. an invasion of…

A: Immune system is composed of cells, organs and proteins. It protects our body from harmful…

Q: How is it possible for some molecules to be atequilibrium across a biological membrane and yet not…

A: Introduction :- Biological membranes are made up of two sheets of lipid molecules (known as a…

Q: Bloom's Syndrome is an autosomal recessive disorder due to mutations in a helicase protein. Some of…

A: Bloom syndrome is an inherited disorder characterised by low height, a sun-induced skin rash, and a…

Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.

A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

During DNA replication, the function of RNA primers is to
serve as a binding site for DNA ligase
open replication bubbles
O serve as starting points for DNA strand elongation by DNA polymerase I in the 3'
- 5' direction
as starting points for DNA strand elongation by DNA polymerase III in
ser
prokaryotes
prevent new-separated strands of DNA from rejoining

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ______. a. phosphate-group transfers from ATP b. DNA polymerase c. the nucleotide itself d. a and c
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
During DNA replication, the function of RNA primers is to Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase
Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
The reaction in DNA replication catalyzed by DNA ligase isa) Addition of new nucleotides to the leading strandb) Addition of new nucleotide to the lagging strandc) Formation of a phosphodiester bond between the 3’-OH of one Okazaki fragment and the 5’-phosphate of the next on the lagging strandd) Base pairing of the template and the newly formed DNA strand
Define DNA replication/synthesis and semiconservative replication. In addition, describe and/or define the role(s) of each of the following in the process of DNA replication/synthesis: DNA template strand, 5’ and 3’ ends, DNA helicase, DNA polymerase, single-strand binding proteins, topoisomerase, primase, Okazaki fragments, leading strand and lagging strand.
(e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable?
List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a replicationfork.
Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of rapid celldivision, replication could start from the origin before thepreceding replication cycle is complete. How many replication forks would be present under these conditions?
Plssss helppppp. Describe the purpose of DNA replication. What is it and why is it important?
Indicate whether each of the following statementsrelating to aspects of DNA replication is true or false.a. The lagging strand grows in the same direction as thereplication fork moves.b. Growth of the leading strand involves the productionof Okazaki fragments.c. Lagging strands always involve “daughter” DNAsegments, and leading strands always involve“parent” DNA segments.d. The enzyme DNA ligase effects the unwinding of aDNA double helix.