The combination of ozone, volatile hydrocarbons, nitrogen oxide, and surnlight in urban environments produces peranyacetylnitrate (PANI, a potent lachrymator. PAN decomposes to acetyl radicals and nitrogen diaxide in a process that is second order in PAN HO HO H-C-C-o-o- H-c-č-o-c H. 1st attempt See Periodic Table Part 1 The half-life of the reaction, at 38.00 °C and Pw 15.22 torr, is 186.89 hr. Calculate the rate constant for the reaction torr 'hr O See Hint Part 2 Determine the rate of the reaction at 38.00 C and Pr 15.22 torr torr/hr

Q: Determine the value of the equilibrium constant, Kgoal, for the reaction N2(g) + O2(g) + H2 (g) = ¿N...

A: Calculate the value of Kgoal by using above reaction ---

Q: Example 8 Calculate the corrosion rate in mpy of Al specimen (5 cm²) immersion in aqueou 2 days, giv...

A: Area = 5cm2  

Q: 2. Meanwhile, Jenny is given 250 mL of solution which is 0.0376 N Magnesium iodide from a pure solid...

A:

Q: Consider the following reaction at equilibrium. What will happen if the pressure increased ? 4FES2(s...

A:

Q: on the f onditions needed to form the product 3. Provide the reactant and reaction H HO

A: ANSWER 23. Given product is cis-1,2-diol . means it is an example of syn-dihydroxylation , which occ...

Q: A sample of meat scrap weighing 2.000 g is digested with concentrated sulfuric acid and a catalyst. ...

A: The excess 0.6700 N  H2SO4  requires to neutralize NaOH. The volume of 0.6700 N H2SO4  requires can ...

Q: EN is infusing continuously at 50 ml/hr. A medication is started that requires the EN to be held 1 h...

A: EN is infusing continuously at 50 ml/hr.

Q: Calculate the mass in kilograms of 11.9 mol of CuF2 2H20. kg CuF2 2H20

A:

Q: Questions: 1) Explain the molecular basis of the reaction of bromine water with phenol. 2) What is/a...

A: These given reactions are the preliminary tests of functional group’s detection in organic chemistry...

Q: Calculate the cell potential of the cell: Use Nernst Equation and Debye Huckel Law Pb(s)PbBr2(s) | C...

A: Nernst equation is the equation for determining the cell potential for a given cell for a particular...

Q: What are three observations that would indicate a chemical reaction has taken place?

A: When a chemical reaction takes place, some changes are observed. These changes help us to check that...

Q: An aqueous solution contains 0.26 g of an organic compound in 1 L of solution. The osmotic pressure ...

A: a) Given, Mass of the organic compound (m) = 0.26 g Volume of the solution (V) = ? Osmotic pressure ...

Q: Some measurements of the initial rate of a certain reaction are given in the table below. N2|H2| ini...

A:

Q: Which statement is correct? I. The carbons in a chair conformation will have two axial or two equato...

A:

Q: Write the ionization constant expression for a 50 mM aniline solution (pKb=9.40 @ 25 C).

A:

Q: ОН H2N, CH2CH3 CH2NH2 HgCO,,, HOOC,,, СООН CHO HOH2C НО A H2NH2C OH НООС. E `NH2 D H3CSH2C

A:

Q: 3 complete total synthesis of Delta9 THC (all the steps of the mechanism)

A:   Total synthesis of Delta9 THC: Total synthesis: Total synthesis is the complete chemical synthesis...

Q: kinetic thermodynamic product product

A:

Q: 500 mL of 0.75 N of K2Cr207 from a pure solid reagent if it follows the following half reaction – Cr...

A:

Q: For each addition route of the reaction, draw the structure(s) of the major product(s), including st...

A: Answer of the question given below, 

Q: Hl ОН The structure shows which configuration? AR B) s

A:

Q: Explain the reasoning for the baking soda and vingear balloon experiment. Fill in the blank. If baki...

A: When baking soda and vinegar are mixed together then the formation of carbon dioxide gas take place ...

Q: 1. 2. 3. 1. 3. 3. 2. M NaHSo 18.5 second lowing ermining the Rate Law for a Chemical Reaction ata Sh...

A:

Q: K goal, fc

A:

Q: What is the vapor pressure at 100 degree celsius of a solution containing 1.68 g of sucrose (MW 342....

A: The relative lowering of vapour pressure is equal to the mole fraction of solute present in the solu...

Q: Identify the proper form of the equilibrium-constant expression for the equation N2 (g) + O2 (g) = 2...

A:

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

A:

Q: Calculate the molar concentration of nitric acid (63.0 g/mol) in a solution that has a specific grav...

A: Given,  % w/w = 70.5%  Specific gravity = 1.42  Density of solution = 1.42 g/ml  Molar mass of Aceti...

Q: 21. Based on your knowledge concerning halogenation of alkenes, provide a step-wise curved arrow mec...

A:

Q: A new temperature scale, know as the Ungoogable (U) scale is related to Fahrenheit (F) in this way: ...

A:

Q: Consider the equilibrium system described by the chemical reaction below. At equilibrium, a sample o...

A:

Q: K 3: STRONG OR WEAK! ions: Relate the properties of liquids to intermolecular forces. Tell whether e...

A: Intermolecular forces of attraction is the force that exist between two molecules.   

Q: Example 3 A sample of zinc anode corrodes uniformly with a current density of 4.27 x 107 A/cm² aqueo...

A: Current density = 4.27 × 10-7 A/cm2

Q: 1. LIAIH,, (CH,CH,)0, –10C H. 2. H', H0 1 CH3 [1] CH;CH,0 [2] H20 I [1] CH;S- H H. [2] H20

A:

Q: 3. Draw a Fischer projection of: a) (S) 3-iodo-1-butene

A: for determine the R/S configuration arrange the atoms by using CIP rule that is the numbering the at...

Q: 19. Provide a complete curved arrow mechanisms that accounts for the transformation below. Be sure t...

A: At first double bond take H+,possible formation of two carbocation one is 2 degree and another is 1 ...

Q: Consider the following reaction in chemical equilibrium: COCl2 (g) = C0(g) +Cl2 (g) What is the effe...

A:

Q: The activation energy for a certain reaction is -164 kJ/mol.  If the rate constant is 117 M-1 s-1 at...

A:

Q: Calculate the quantity of heat in kJ, associated with a 33.5oC decrease in temperature in a 5.85 kg ...

A:

Q: ions

A:

Q: e boiling point of

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: 1) O, 2)Me,S 1)KMNO,/heat 2) H,O*(aq) NBS RO-OR 1) BHSTHF 2) NAOH/ROOR H,O°(aq)

A:

Q: What is the difference between an orbit (such as in the Bohr model) and electron orbital?

A: Orbit is the Path for elcetrons to revolve around the nucleus. While electron orbital is the 3-D mot...

Q: Calculate the "Third Law" entropy of CCl4 gas at 200 °C from the following data for CCI4- o S'298(li...

A:

Q: 2. Lone pair occupies a hybridized p-orbital allowing it to delocalization to a nearby side-way over...

A:

Q: resonance contributors to

A:

Q: The following system is at equilibrium:X(s) +3Y(g) =Z(g)Classify each of the following actions by wh...

A:

Q: t takes a runner 37 minutes to complete a 10 km course. What is his/her average speed in miles per h...

A:

Q: given a stock solution of 2.0%,how would you prepare 10mL of the following solution? find mL stock a...

A:

Q: Part Á The activation energy of an uncatalyzed reaction is 88 kJ/mol. The addition of a catalyst low...

A: