the common variants that swap amino acids in the encoded protein variants that stunt a protein mutation that mixes up the parts of a protein mutation that turns the protein into genetic gibberish missense mutation nonsense mutation splice site mutation frameshift mutation

the common variants that swap amino acids in the encoded protein variants that stunt a protein mutation that mixes up the parts of a protein mutation that turns the protein into genetic gibberish missense mutation nonsense mutation splice site mutation frameshift mutation

Name: Please verify if correct or not. If incorrect, please match descriptio
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please verify if correct or not. If incorrect, please match descriptions with the correct mutation. the common variants that swap amino acids in the encoded proteinvariants that stunt a proteinmutation that mixes up the parts of a proteinmutation tha

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 7P

See similar textbooks

Similar questions

My PDB code: 3GRS residue point: HIS467 mutation: LEU Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words)
A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…
Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words) My PDB code: 3GRS Residue point: HIS 467 Mutation: LEU 467
Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the impact of the disease on society.Describe a way in which your gene can be manipulated to treat the disease. Assume you can make any changes to the protein product and describe specifically how it will affect its interaction with other molecules.
Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible nucleotide sequence in the template strand of the gene that codes for met-enkephalin, assuming that every base of the gene is transcribed and then translated?
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8
Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this?
Titin is a muscle protein named for its size. Its gene has the largest known coding sequence of 80,781 DNA bases. How many amino acids long is it?
Which of the following peptide sequences is most likely to be found in a hydrophobic pocket of the protein containing it DEAD AVGF ACMN GSYK
The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?