A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?

Q: If you were to compare the amino acid sequences of histone proteins across several distantly-related…

A: The histone proteins highly basic protein found in the nucleus of eukaryotic cells. They play a…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by…

A: Hi there! Since you have posted multiple questions, we are answering only first three sub-parts:…

Q: HDAC's are important enzymes involved in the regulation of Gene expression. This is because a. They…

A: HAT stands for Histone acetylase. HDAC stands for Histone Deacetylase.

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: Is it possible to have a mutation in nucleotide four that would produce the same amino acid? If yes…

A: A nucleotide is an organic molecule that is the building block of DNA and RNA.They also have…

Q: The earlier that two genes arose from a duplicated gene, themore their nucleotide sequences can have…

A: The HBB gene encodes instructions to form a protein known as beta-globin or hemoglobin beta. This…

Q: Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are…

A: DNA or the deoxyribonucleic is the defined genetic material and it is made up of a base, deoxyribose…

Q: Explain the genetic advantage for the codon 5'-AAG-3' to code lysine and the codon 5'-AGG-3' to code…

A: Introduction Any of the 64 distinct DNA sequences of three consecutive nucleotides that either…

Q: Adult hemoglobin is a multimeric protein with fourpolypeptides, two of which are α-globin and two…

A: Haemoglobin is a protein that is responsible for oxygen transport in most of the vertebrates.  This…

Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…

A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…

Q: Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe…

A: amino acids can be neutral, positively or negatively charged. this is due to the number to charged…

Q: Do the phosphate and the pentose groups give homogeneity or heterogeneity to the nucleic acid…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: Histone proteins contain tail amino acids that are positively charged. Which of the following…

A: DNA is a helical structure  that carries the genes or the hereditary units of life. DNA is a…

Q: The A+T: G+C ratios in DNA of cattle and rat are very similar. Would you expect the tRNA, rRnas, and…

A: Chargaff's rules state that DNA from any species of any organism should have a 1:1 protein…

Q: A protein chemist told a molecular geneticist that he had found a new mutant hemoglobin in which…

A: A codon is a group of three consecutive nucleotides that specify an amino acid. Four different…

Q: . The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age…

A: Amyotrophic lateral sclerosis (ALS) is a paralyzing neurodegenerative disease which is usually fatal…

Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…

A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: Explain Mutations in a gene are colinear with the sequence of amino acids in the encoded…

A: A change in DNA sequence is called Mutation. This may be a result of an error in DNA…

Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…

A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…

Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…

A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…

Q: Sickle-cell disease is caused by a so-called point mutation in the humanβ-globin gene. A point…

A: Two b-globin polypeptides combine with two a-globin polypeptides (encoded by another gene family)…

Q: On the basis of current knowledge, the protein-encoding regions account for only about 3% of the…

A: The Central Dogma of molecular biology states that: DNA makes RNA, which makes Proteins. However, a…

Q: . Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some…

A: A normal molecule of haemoglobin consists of four globin chains (two alpha and two beta chains).…

Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…

A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…

Q: . Can a missense mutation of proline to histidine bemade with a G • C → A • T transition-causing…

A: A missense mutation is a point mutation that occurs in a codon that codes for a different amino acid…

Q: If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed

A: If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed?…

Q: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense…

A: A missense mutation causes change in a single nucleotide. The resultant codon codes for an amino…

Q: I only need letter D

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously…

A: Answer of the question given below...

Q: Which of these mutations would you predict to be most detrimental?  Explain your answer.  (Refer to…

A:

Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…

A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…

Q: 1. You are investigating a protein that has the amino acid sequence N... Ala – Thr - Asn – Trp – Lys…

A: BASIC INFORMATION  GENETIC CODE  The codes are written in a group of three thus it is triplet.…

Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…

A: The genetic code is a system of principles that live cells employ to convert data contained in…

Q: identify all the amino acid-specifying codons in thegenetic code where a point mutation (a single…

A: The mutation is sudden change occurs in genetic material. It can be due to ultra-violet rays,…

Q: A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the…

A: Mutation is defined as the alteration in gene that result in alteration in the function of the…

Q: Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of…

A: It is one of the types of mutations subclassified on the basis of the effects on the function of…

Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…

A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…

Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…

A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: With respect to DNA binding motifs and their characteristics choose the correct answer O A. All DNA…

A: DNA-binding domains (DBD) are protein domains that can fold independently. They have at least one…

Q: The amino acid sequences of peptide fragments obtained from a normal protein were compared with…

A: DNA is not directly involved in the expression of traits thus it acts as a master copy of genetic…

Q: A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair…

A: It was estimated by scientists that in the genome of humans, there are around 10 million locations…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.