the concentration in

Q: 1. LIAIH,, (CH,CH,)0, –10C H. 2. H', H0 1 CH3 [1] CH;CH,0 [2] H20 I [1] CH;S- H H. [2] H20

A:

Q: ions

A:

Q: Draw the kinetic and the thermodynamic addition products formed when one equivalent of HBr reacts wi...

A: The thermodynamic and kinetic product is given below

Q: Which of the following is not a strong acid in aqueous solution?     HBr     H2SO4     HI    ...

A: Which of the following is not a strong acid in aqueous solution?

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

A:

Q: The Ungoogable scale is related to kelvin by the following equation: TK = Tu + 173 If Tu = 173.50 de...

A: Temperature in kelvin is related to temperature in some unknown units as shown below: TU = TK + 173 ...

Q: Dimensional analysis You bought $30 worth of bananas. How many bananas did you buy? Assume that bana...

A:

Q: Describe (in detail) the preparation of 800 mL of 50 parts per thousand of Cl- from 0.02 M Lead(II) ...

A: Here we have to prepare 800ml of 50 parts per thousand of  Cl- from 0.02 M PbCl2 solution.

Q: 4. a. One liquid has a temperature of 140°F and another liquid has a temperature of 60°C. Are the li...

A: Temperature of first liquid = 140°F Temperature of second liquid = 60°C

Q: Under certain conditions the rate of this reaction is zero order in hydrogen iodide with a rate cons...

A:

Q: If a basketball is inflated to an internal pressure of 2.18 atm at 25 ∘C and then taken outside, whe...

A: The answer is given below

Q: Which of the following acids has the weakest conjugate base?     Chlorous acid, Ka = 1.1 x 10-2  ...

A: The strongest an acid , the weakest is its conjugate base.  The acid which has highest Ka value is s...

Q: Cisplatin preferentially binds N' of the purines adenine and guanine. Draw the product of the follow...

A: The correct answer is given below

Q: box is not needed leave it blank. o reaction occurs leave all boxes blank and click on "Submit". e a...

A: NaOH is a base while nitric acid is an acid. Both are strong base and strong acid and together combi...

Q: A secondary step in the process to produce ultra-pure silicon is to combine silicon tetrachloride wi...

A:

Q: A mixture initially contains A, B, and C in the following concentrations: [A] = 0.400 M , [B] = 1.40...

A: We have to predict the Kc value.  

Q: Example 3 A sample of zinc anode corrodes uniformly with a current density of 4.27 x 107 A/cm² aqueo...

A:   Step = 1st Solution      The following reaction:            Zn→ Zn 2+ + 2e Corrosion Rate =     (...

Q: Balance the following equation with the smallest whole number coefficients. What is the coefficient ...

A: The balanced equation and coefficient of Oxygen in balanced equation is given below

Q: Draw (be specific on the structures of each component in the cycle) and explain the entire process o...

A:

Q: 3. Molality How many grams of solute is present in 2.5 moles Magnesium hydroxide, Mg(OH)2 in 669 g w...

A: Molar concentration of a solution can be defined as the number of moles of solute dissolved per litr...

Q: Some measurements of the initial rate of a certain reaction are given in the table below. [N2] H2 in...

A:

Q: 19. Provide a complete curved arrow mechanisms that accounts for the transformation below. Be sure t...

A: At first double bond take H+,possible formation of two carbocation one is 2 degree and another is 1 ...

Q: If a mixture of solid nickel(II) oxide and 0.13000 M carbon monoxide is allowed to come to equilibri...

A:

Q: Describe how you would prepare 100 m L of a solution that is 22 % acetic acid by volume .

A: We have to mix acetic acid in some solvent.

Q: CH,O. (CH,CH,CH,CH,),Culi 44 CHO [1] NaH HO. (2) CH;CH,CH,Br 45

A: Although Cu containg reagent prefer for 1,4 addition but due to bulky group here 1,4 addition is not...

Q: Q.No. 5 Absolute stereochemistry of the given compound is: 8a 4a OH (A) 4aR. 8aS (B) 4aR. 8aR (C) 4a...

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: - the Diels-Alder reaction.

A:

Q: Sulfanilamide, a sulfur drug, acts as an antibiotic. Explain its mechanism of action in the context ...

A: Ans. Sulfanilamide: An enzyme Inhibitor: Sulfa drugs work by binding and inhibiting a specific enzym...

Q: (d) (e) (f) CH3CHCOH CI NH2

A: Answer of the question given below, 

Q: Reaction quotient is the concentration of the products raised to the stoichiometric coefficients div...

A: Which statement is TRUE....

Q: In their second titration trial, a student calculated that a 27 mg sample of their antacid neutraliz...

A:

Q: 4.) What is the product of the following reaction? my heat

A: It is a [4+2] Intramolecular di-alder reaction.

Q: Consider the following reaction at equilibrium. What effect will reducing the volume have on the sys...

A: Given reaction: C3H8 (g) + 5O2 (g) ↔ 3CO2 (g) + 4H2O (l) We have to find the effect of reducing the ...

Q: Write the balanced NET IONIC equation for the reaction that occurs when hydroiodic acid and potassiu...

A:

Q: What is the reason for the stoke shift for a fluorophore ? Please shortly answer at your own words. ...

A: Stokes is the energy difference between absorption and emission in cm-1.

Q: 21. Based on your knowledge concerning halogenation of alkenes, provide a step-wise curved arrow mec...

A:

Q: the equilibrium constant for t

A: Equilibrium constant is defined as a constant which explains the relationship between the concentrat...

Q: Which of the following delocalizations will be exhibited by the compound below? OH A sigma electron ...

A:

Q: Read carefully the given partial names in IUPAC alkane nomenclature and check the columns where they...

A:

Q: A cubit is a measurement of distance from the ancient near east which is equivalent to about 1.5 fee...

A: 1 cubit = 1.5 feet and  1 meter = 3.28 feet Calculations are done in the following step.

Q: H3CHN A H2N H3CO- O- ENH H3COCH2CH2C CH2CH2CH2OH E H3CH2CH2CH2C CH2CH,COOH OH

A: 39. If each doubly bonded carbon atom in a compound is attached to different atoms/groups, 'E-Z' nom...

Q: Consider the following reaction at equilibrium. What will happen if O2 is added to the reaction? 4FE...

A:

Q: Under certain conditions the rate of this reaction is zero order in dinitrogen monoxide with a rate ...

A: The integrated rate equation for a zero order reaction is,    [ C ]t  = -kt + [ C ]0   [ C ]t   = Co...

Q: Three resonance structures of the given anion are possible. One is given, but it is incomplete. Comp...

A: Delocalisation of pie electrons in molecules is known as resonance, electrons flow from higher densi...

Q: Q4: Identify the structural effect present on the given molecule.

A: The structural effect present in compound depend on the functional group present in present 

Q: 11:36 O ... 66 X How many grams of Au are in ../1 0.053 mol of Au? 1 X How many Ga atoms are in ./1 ...

A: We know that,  Number of moles = mass/molar mass 

Q: A soft drink costs 75 cents for a 12-oz can. A two-liter bottle costs $1.25. How much more expensive...

A:

Q: 12. Provide one other contributing resonance form for structures A, B, and C. Show all electron move...

A: Resonance structures are formed by movement of pair of electron or single electron.   

Q: 9 (c) (i) Complete the diagram to show the mechanism of this reaction. Include all necessary charges...

A: This reaction is the nucleophilic addition between acetaldehyde and Sodium cyanide. The product of t...

Q: Calculate the pH of a 0.100 M solution of lactic acid, for which the Ka value is 1.40 x 10-4.

A: