The degradation of nutrients for energy is also known as oxidative metabolism.  True  False

Q: In the table below, name each functional group in anserine that is ionizable and record an estimated…

A: Serine is an amino acid with molecular formula C3H7NO3. Its molecular weight is 105.09 g/mol. Serine…

Q: what 3 types of lipids exist? Give an example of each.

A: Introducion Lipid is a biomolecule consists of carbon, hydrogen, and oxygen. Lipids are water…

Q: Even though HbA is a heterotetramer (not all the subunits are the same), the alpha- and beta-globin…

A: Haemoglobin is a carrier protein that carries oxygen to the cells . It is present in red blood cells…

Q: ________ is a regulatory mechanism in which the end product of a metabolic pathway inhibits an…

A: Enzymes are biological catalysts. The enzymes, whose ability to catalyze a reaction depends upon…

Q: Consider a uniport system where a carrier protein transports an uncharged substance A across a cell…

A: ∆G = R T ln (Ainside /Aoutside)  Where G is free energy change for the transport of uncharged…

Q: 6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group…

A: Protein modification - Major types of proteins modifications are phosphorylation, acetylation and…

Q: 1. Under what circumstances in the cell would the entire pentose phosphate pathway be carried out…

A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…

Q: 1. How does the resin facilitate purification in glutathione S-tranferase (GST) affinity?   2.…

A: Glutathione S-tranferase (GST) is a large family of proteins that are involved in the detoxification…

Q: What are the 3 steps of amino acid degradation:

A: Amino acids are biomolecules that act as the building blocks of proteins. Biologically important…

Q: 2. The role of coenzymes in realizing the catalytic activity of enzymes.

A: Enzymes are biocatalysts that increase the rate of biochemical reactions by carrying out quick…

Q: For the tetrapeptide KASE: a. Draw its complete protonic equilibria. Indicate the net charge of each…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Phosphatidic acid phosphatase (PAP), also called lipin, converts phosphatidate to diacylglycerol…

A: Phosphatidic acid phosphatase (PAP) or lipin converts phosphatidate to diacylglycerol (DAG), while…

Q: What's the importances of Nucleic acid

A: - The most crucial macromolecules for maintaining life are nucleic acids. They contain instructions…

Q: How does ATP releases the energy used by the Cell/What happens to ATP for the energy release/what…

A: ATP is also known as adenosine triphosphate. ATP is also called the energy currency of the cell. ATP…

Q: What charged groups are present in lysine at a pH = 7?

A: Amino acids are building blocks of proteins. The alpha carbon of amino acids consist of amine group,…

Q: Vitamin B3: coenzyme form, functional groups, mechanism of action, biological role, sources, daily…

A: Vitamins are essential nutrients that are required in lesser amounts but are very essential for…

Q: Triacylglycerols Store Energy Q4.3 - Describe the three sources of triacylglycerols in humans and…

A: Introduction: Triacylglycerols are also known as neutral fats or triacylglycerides, which are esters…

Q: The word root erythr/o means? Don't copy

A: The identification of affixes in biological terms can help in the understanding the complex terms.…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Which of the following is NOT a naturally-occurring amino acid? A) B) C) D) H₂NCH-COO CH3 H₂NCH-COO…

A: The proteins are composed of twenty naturally occurring amino acids. These amino acids are alpha…

Q: 1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure.…

A: Supercoiling means the coiling of the coil. Cellular DNA is extremely compacted and implies a high…

Q: ĭ HO O-C-R' O=O=O=O -O-C-R" -O-C-R"" A -P=00=0 HII -N-C-R" OH E O-sugar O || -0-C-R" -NH3+ -(CH₂)12…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: The net yield of ATP for the complete oxidation of one molecule of glucose is O 10 ATP O 24 ATP O 30…

A:

Q: Mixtures of amino acids can be analyzed by first separating the mixture into its components through…

A: In ion exchange chromatography the column support matrix is constituted of beads to which charged…

Q: DNA: Explain the Meselson-Stahl Experiment.

A: The mode of replication in DNA, in which a parental duplex DNA gives rise to two identical daughter…

Q: 4) For various amino acid pairs (for example: F to A, E to R, D to N, V to L, S to W), ask yourself:…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: how would I sequence this trypsin digest.  Please explain step by step

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best…

A: Introduction :  Inulin - Inulin is a type of  naturally occuring polysaccharide which is produced by…

Q: 1. You were asked to prepare 1.0 L of a 0.10 M solution of sulfuric acid from a 3.0 M solution of…

A: Solutions of different concentrations of salts and acids need to be prepared for routine laboratory…

Q: 10. Vitamin B6: coenzyme form, functional groups, mechanism of action, biological role, sources,…

A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…

Q: Which of the following is not a suitable starting compound for gluconeogenesis? A. Lactate B.…

A: DISCLAIMER FOR MULTIPLE   Since you have asked multiple question, we will solve the first question…

Q: Fill in the blanks In the given reaction below, the amino acid HỌC NHỚ Coo NH4+ 2 0₂ H₂O₂ HC=0 coo…

A: Amino acids are converted to keto acids inorder to fuel the central process of the cell like…

Q: Fill in the blanks: In the peptide, LASALLEDASMA, (Write the full name of the amino acids) has the…

A: The amino acid composition of the given peptide is as follows:…

Q: Draw the pentapeptide REACH (one letter abbreviations) in the most prevalent ionization state at 8.4…

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: what are the chemical methods for glucose determination and their clinical significance?

A: Glucose is the most important carbohydrate fuel of the body. The normal concentration of glucose in…

Q: Provide methodologies for the correct use of pH meter.

A: Introduction A pH meter is an electric instrument which is used to measure the hydrogen ion activity…

Q: In an Absorptive (fed) state Which predominates? Anabolic or catabolic processes? Which ones…

A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…

Q: 9.) How many grams of H₂0 must be used to dissolve loog of sucrose (C₁2H₂2011) to prepare a 0.020…

A: Mole fraction is the ratio of moles of one component in a mixture to the total no of moles of all…

Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…

A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…

Q: Which of the following concerning hemoglobin is true? a) BPG decreases at high altitudes and causes…

A: 1 Hemoglobin is a globular protein, ie it is roughly spherical. It is an oxygen-binding protein that…

Q: what is the dimer of proteins

A: A protein is a biomolecule consisting of many amino acids. It functions as building blocks of the…

Q: 5. Oxaloacetate, glycerol, and lactate can be used in gluconeogenesis. T F

A: Sometimes organisms need a method to synthesize glucose from non-carbohydrates precursors. The…

Q: If there is ample oxygen available, how many ATP can be produced from complete oxidation of glucose…

A: The aerobic breakdown of nutrients into carbon dioxide, water, and energy occurs during aerobic…

Q: When a person becomes dehydrated the amount of water in extracellular fluids such as blood…

A: Osmosis is the movement of water molecules from an area of low solute concentration (high…

Q: One advantage of the protein structures solved by NMR comparing to the x-ray structures is: a. It…

A: Proteins are composed of amino acids attached together via peptide bonds. There are twenty standard…

Q: diabetic patient has a sodium concentration of 141 mmol/L, a glucose concentration of 742 mg/dL and…

A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…

Q: It is obtained from the milky secretion of various plants such as the tree Hevea brasiliensis.…

A: Hevea brasiliensis, the Para rubber tree, or most commonly, rubber tree or rubber plant, is a flower…

Q: Conversion of oleic acid to its more stable trans-isomer can be triggered by light. Do you think…

A: Oleic Acid (OA): An omega-9 fatty acid is an oleic acid. The body can produce it. Foods contain it…

Q: Count Experiment Name: Specimen Name: Tube Name: Record Date: SOP GUID Display Range Population P1…

A: The flow cytometry data in the given image uses BV-605 as the fluorescent molecule. From the…

Q: The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine…

A: Alkaline hydrolysis is a process by which RNA is degraded dur to attack of -OH ions of alkali. The…

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.