What charged groups are present in lysine at a pH = 7?
Q: Which of the following statements concerning glycolysis is correct? O The pathway for the process is…
A: The first process in breaking down glucose to release energy for cellular metabolism is called…
Q: 1. What happens to the pyruvate made during glycolysis under anaerobic conditions? Is this a redox…
A: Glycolysis is the breakdown of one molecule of glucose (6C) into two molecules of pyruvate (2 x 3C)…
Q: HN 1. 2. 3. 4. 5. NH CH₂ EB HẠN–ệ—C H 8 Choose A if the statement is CORRECT B if the statement is…
A:
Q: he transport of nutrients into a cell (think glucose and amino acids, for example) is a crucial…
A: The carbohydrates are absorbed in the intestine in the form of monosaccharides. The hexoses that are…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: 7. To what volume must 30 mL of a 2.5M NaOH solution be diluted to make a 0.4M solution?
A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…
Q: Which one of the following features does NOT make HDL a 'good' lipoprotein. It acts as an…
A: High density lipoprotein is the smallest lipoprotein with a size of 5 to 17 nm. It functions to…
Q: a) A plasmid DNA in bacteria has a length of 14,000 bp and an Lk of 1300. Calculate the superhelical…
A: The linking number of DNA describes the topology of a double-stranded DNA. It is the number of times…
Q: 13. Vitamin H: coenzyme form, functional groups, mechanism of action, biological role, sources,…
A: Introduction: Vitamins are chemical compounds that are found naturally in plants and animals. It is…
Q: What is the product of the oxidation of this fatty acid?
A: The aerobic fatty acid oxidation mechanism in the mitochondria converts a fatty acid into acetyl-CoA…
Q: Proteins in/on target cells that bind messenger molecules and cause a response in the cells are…
A: Proteins are made up of amino acids which are used as a monomer unit of proteins. 22 standard…
Q: Which of the following statements about the malate-aspartate shuttle is false? a) 2.5 ATPs are…
A: Malate-aspartate shuttle : It is a Biochemical mechanism which translocates the electrons which are…
Q: Which of the following statements concerning enzymes is TRUE? a. Enzymes can increase the…
A: Enzymes are biological catalysts that enhance the rate of biochemical reactions. The enzymes are…
Q: Now, assume that a hypothetical two-subunit hemoglobin has an n of 2. The ratio of the…
A: Our hypothetical Hemoglobin (Hb) consists of 2 subunits . 'n' denotes the number of binding sites in…
Q: For the enzymes involved in producing ATP at an extremely high rate, please indicate the products…
A: ATP (adenosine triphosphate) is the energy currency that the cell uses in metabolic transactions.…
Q: 3. The amino acid histidine has a side chain with a pK₁ of 6.0. What percentage of the histidine…
A: The ionization of histidine sidechain can be represented as below. HH+ ⇌ H + H+ here 'HH+ ' is the…
Q: how would you prepare a 3-fold dilution series
A: Serial dilution : A substance is diluted in a solution step by step in a serial dilution procedure.…
Q: 1. The R group of the amino acid lysine is: -CH2-CH2-CH2-CH2-NH2. Draw the structure of lysine,…
A: Amino Acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: In the given segment showing parallel strands, there are a total of In a parallel 3 sheet, hydrogen…
A: Beta sheets are secondary structures of proteins. They can be formed by a single peptide chain or…
Q: The normal concentrations for intracellular and extracellular potassium in a neuron are [K+]in = 150…
A: Recall that the Nernst equation for calculating reversal potential is: Eion = RT/Zf log [Co]/[Ci]…
Q: Which peptide has a larger pI? Arg-Gly-Gly-Gly or Gly-Gly-Gly-Arg why?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Give at least 10 functions of protein and describe each function. Cite an example for each function…
A: Proteins are the bio molecules which are very diverse in their structure and function. There are…
Q: A.We have seen from history the role science has played in the prevention and control of diseases.…
A: Epidemiology : It is the study of diseases in a population, studying the reason , how it spread, why…
Q: What is the major driving force that works in favor of tertiary protein structure formation (protein…
A: Proteins are the complex macro molecules that show four levels of structural organisation. They are…
Q: Which of the following is not a suitable starting compound for gluconeogenesis? A. Lactate B.…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: give a clear handwritten answer only with explanation..Draw 5’-A-A-3’ ribonucleotide with 5’…
A: Ribonucleotides are made up of ribose sugar, a nitrogenous base and a phosphate. These are present…
Q: Provide a detailed plan and explanation on how to synthesize the following peptide by using Fmoc-…
A: Solid phase protein synthesis is a very powerful technique for the generation of synthetic oligo…
Q: Glycolysis Glucose Pyruvate Pyruvate Oxidation Citric Acid Cycle Oxidative Phosphorylation (electron…
A: Introduction Cell requires energy for the various activities. Cell gets energy by cellular…
Q: 1. State if true or false a. Gluconeogenesis is the exact opposite of the glycolytic pathway b.…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: In a 2017 study examining the efficacy and safety of its use in patients with mild-to-moderate…
A: The given drug has three ionizable groups. It is made up of the amino acid Lys, Pro, and Thr. The…
Q: Draw the Conversion of Pyruvate to Acetyl CoA pathway and identify the different types of organic…
A: Pyruvate is formed from glucose during glycolysis. Conversion of pyruvate to acetyl CoA takes place…
Q: 1. By mistake, a student placed microdrops of solutions of alanine and leucine on the same point on…
A: All the 20 standard amino acids except proline have a primary amine group . Ninhydrin is a very…
Q: Describe how the following allosteric effectors regulated Hemoglobin’s O2 affinity: • CO2 • H+ (pH;…
A: Both Myoglobin and hemoglobin (Hb)contain the heme prosthetic group and the inorganic co-factor…
Q: What is the purpose of soaking the egg in vinegar? Explain the rationale of vinegar reaction to the…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: QUESTIONS: 1. What is a reducing sugar? 2. Explain why sucrose is not a reducing sugar. 3. How can…
A: All the three questions are related to carbohydrates. They are answered in the next steps.
Q: A biotechnology company focused on peptide therapeutics is investigating the properties of several…
A: First thing one must observe while studying any peptide sequence is to look at the nature of the…
Q: In the alpha-helices, which of the following statement is NOT true? a. Backbone carbonyl…
A: Proteins are composed of amino acids that are attached together via peptide bonds. The linear chain…
Q: What is something that allosteric effectors that alter the rate of catabolic or anabolic pathways…
A: Enzymes are biological catalysts that alter the rate of biochemical reactions. Allosteric enzymes…
Q: The Quikchange cycling parameters are listed below: 1.95 degrees, 2 min 2. 95 degrees, 20 sec…
A: PCR or Polymerase chain reaction is used in molecular biology to make multiple copies of…
Q: 1. List the 3 final products of glycolysis.
A: Glycolysis breaks down glucose into two molecules of pyruvate that occurs in the cytoplasm and ATP…
Q: Intermediary metabolism includes all the reactions in an organism involved in generating and storing…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Water is present in the cell at a concentration of 55.5 M, whereas P, is present at a concentration…
A: Glyceraldehyde phosphate dehydrogenase is a 37 kDa enzyme which catalyzes sixth step of…
Q: what are the chemical methods for glucose determination and their clinical significance?
A: Glucose is the most important carbohydrate fuel of the body. The normal concentration of glucose in…
Q: 7. Which of the following statements regarding the regulation of glycogen metabolism is false? A.…
A: In human body, when there is excess of glucose in blood, insulin acts on the hepatocytes and muscle…
Q: His-Met-Asp-Tyr-Phe-Ser Calculate an approximate pI (isoelectric point) for this peptide. Please use…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: he write a conclusion and if the hypothesis was (rejected, modified, or supported) Questions: 1.…
A: Enzyme assays are laboratory tests undertaken to figure out the kinetics of an enzyme catalyzed…
Q: Arginine has three ionizable groups. The pK of α-COOH is 2.18; α-NH 3 + , 9.09; and the R-group,…
A: Isoelectric point (pI) is the pH at which the net electric charge of the amino acid is zero. When,…
Q: 1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure.…
A: Supercoiling means the coiling of the coil. Cellular DNA is extremely compacted and implies a high…
Q: 1. How does the resin facilitate purification in glutathione S-tranferase (GST) affinity? 2.…
A: In Biochemistry, affinity chromatography is a technique used for the purification of protein based…
Q: Chemistry Most of the reactions in gluconeogenesis are the simple reversal of the ‘forward’…
A: In gluconeogenesis pathway, the formation of phosphoenolpyruvate from oxaloacetate is catalyzed by…
Step by step
Solved in 2 steps
- Which of the following compounds would be most soluble in carbon tetrachloride, CCl4? a. NH3 d. CH3OHb. H2O e. C6H6c. HClIt is speculated that, in 1954, the scientist Allan Turing (who was instrumental in decoding the German Enigma code during the Second World War) ate an apple, which had been injected with a solution of cyanide, to commit suicide. How does cyanide poisoning work on a molecular level, and why can this type of toxic effect not be prevented as in the case of methanol poisoning?For each of the following chemicals, name the general class they belong to, discuss their solubility in water and explain why they are/are not soluble in water: a) CH3(CH2)26COOH b) KCl c) CH3
- Which of the following linkages is found in sphingolipids? a. sphingosine-choline-phosphate b. sphingosine-phosphate-choline c. phosphate-sphingosine-choline d. none of the aboveDraw the structure of a triacylglycerol containing stearic acid, palmitic acid, and oleic acid.Which of the following statements concerning glycolipids is true? a. All glycolipids contain sphingosine. b. All glycolipids contain one sugar residue. c. All glycolipids contain phosphatidylglycerol. d. Some glycolipids contain ceramide, while others do not.
- How many grams of glucose (C6H2O6 molecular mass =180daltons) would be present in one liter of a 1M (molar) solution of glucose?Identify the following features of this phospholipid, which is needed for the brain and nerve tissues: Is the phospholipid formed from glycerol or sphingosine? What is the fatty acid? What type of bond connects the fatty acid? What is the amino alcohol?For each of the following chemicals, name the general class they belong to, discuss their solubility in water and explain why they are/are not soluble in water (note the numbers are all subscripts): a) CH3(CH2)26COOH b) KCl c) CH3OH
- Where would the following substances partition in water containing palmitic acid micelles? (a) H3C—(CH2)11—COO−, (b) H3C—(CH2)11—CH3In a 0.1000 M acetic acid solution at 25 degrees celsius , the acid ionizes to the extent of about 1.34 %. Since each molecule of acetic acid which ionizes produces 1 H+ ion and 1 C2H3O2- ion, the concentration in the solution are: HC2H3O2 < -----------> H+ + C2H3O2-a. How many water molecules are released when a triglyceride isformed?b. How many peptide bonds are in a hexapeptide?