The Directory class has a list of names in it. You should use dynamic memory to create an array upon instantiation. You should create a copy constructor for the directory class and an assignment operator (i.e. operator=()). You should create a function called fillDirectory which accepts a size for the directory and the names for it both of which should be given by the user. In main, create directory1 and fill it with information. Use the assignment operator=() to set directory2 equal to directory1. This is in c++

The Directory class has a list of names in it. You should use dynamic memory to create an array upon instantiation. You should create a copy constructor for the directory class and an assignment operator (i.e. operator=()). You should create a function called fillDirectory which accepts a size for the directory and the names for it both of which should be given by the user. In main, create directory1 and fill it with information. Use the assignment operator=() to set directory2 equal to directory1. This is in c++

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter8: I/o Streams And Data Files

Section8.4: File Streams As Function Arguments

Problem 2E

See similar textbooks

Similar questions

My Question starts here In the code linked Implement a function readEmpFromFile that takes a FILE * as the only argument and returns a pointer to a struct employee. This function should read the information from the file (reversing what writeEmpToFile does), create a new employee and fill in the data. If the FILE has no more info (is at end of file), this function should return NULL. This function must also ensure any employee actually created (not the NULL) is added to the array (as is done in createEmployee). Change main to load employees from a file if a command line argument is given to the program (using your readEmpFromFile function you just wrote). Question ends here To make it easier so that you do not have to go through the entire code I'm going to put writeEmpToFile function right here after the question but if you still need to look at the full code to get an understanding of what you are working with its linked at the bottom void writeEmpToFile(Employee *emp, FILE…
Write a void function that will merge the contents of two text files containing the chemical elements into a single binary file. The function's parameters will be three file pointers; each text file will contain an integer atomic number followed by the element name, chemical symbol and atomic weight. Here are two sample lines: 11 Sodium Na 22.9920 Calcium Ca 40.08 The function can assume that one file does not two copies of the same elements and that the binary output file should have the same property. IN C PLEASE
Consider the Student class in the provided student.py file. Each student has a name, an id anda list of courses taken. A course is represented as a list with three items to indicate the coursename, semester taken and grade. For example, [‘comp1008’, ‘S24’, 76.3] represents this coursewith a final grade of 76.3. Complete all the functions in the provided a4.py file.
There's an error in the part that "function" was not declared in the code. Can you fix the code? Code: #include <iostream>#include <queue>#include <vector> using namespace std; struct Process { int processId; int burstTime; int priority;}; // Function to calculate average waiting time and average turnaround timevoid calculateAvgTimes(vector<Process>& processes, vector<int>& waitingTimes, vector<int>& turnaroundTimes) { int totalProcesses = processes.size(); int totalWaitingTime = 0; int totalTurnaroundTime = 0; for (int i = 0; i < totalProcesses; i++) { totalWaitingTime += waitingTimes[i]; totalTurnaroundTime += turnaroundTimes[i]; } float avgWaitingTime = (float)totalWaitingTime / totalProcesses; float avgTurnaroundTime = (float)totalTurnaroundTime / totalProcesses; cout << "Average Waiting Time: " << avgWaitingTime << endl; cout << "Average Turnaround Time:…
Information for 20 customers of a bank is stored in a random Access file named musteri.dat using the struct given below. struct customer{ int account;char surname[25]; char name[20]; double deposit; }; 1- Write a function having prototype given below that returns how many customers stored in the file whose deposit is less than zero. Call your function from main function within a menu.Function prototype: int listIndebtedAccounts(FILE *); 2- Write a function having prototype given below that returns the customer information as a struct that has maximum amount of money in his account.how many customers stored in the file whose deposit is less than zero. Call your function from main function within a menu.Function prototype: struct customer findMaxDeposit(FILE *); 3- Write a function having prototype given below that transfers all information of customers into a sequential access file named “list.txt” whose deposit is greater than or equal to 300 . Call your function from main…
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
C++ Inside the following function declaration, make a method that creates a child process. The child process should create a directory named ‘new’ using the ‘mkdir’ command, and the parent process should wait for it to finish and then use the ‘ls’ command to list the folder that contains the new directory. Your solution can be no more than 16 lines long. Namespaces, blank lines, and the declaration written do not count towards this limit. You can also assume that any necessary components are included through the '#include' operand.
Part 1: In C#, Create a Class Called FileRoot As we know, when we run a program, the program runs from the bin folder. If I had a file stored at the root of the project and if the program is running, it wouldn't know where it is unless it came out of the bin folder. Before implementing the classes below, create a class that will help you get from the bin folder to the project's root. Hint: Directory class and its static methods would help here.
Please help me with the assignment below The assignment: Make a telephone lookup program. Read a data set of 1,000 names and telephone numbers from a file that contains the numbers in random order. Handle lookups by name and also reverse lookups by phone number. Use a binary search for both lookups. This assignment needs a resource class and a driver class. The resource class and the driver class will be in two separate files. The driver class needs to have only 5 or 7 lines of code. The code needs to be written in Java. Please help me with exactly what I asked for help.
THIS IS THE REFERNCE FOR COPY:Dictionarya) Define a function createUser() with an arbitrary dictionary parameter. This function returns a dictionary based upon input arguments.b) Define a function printUser() with a parameter user which is a dictionary. This function prints the contents of the dictionary user.c) Create and print the user: John, age 43, job Programmer, Hobby Bikingd) Create and print the user: Sara, age 20, school QCC, major CSIS ANSWER THIS QUESTION: Modulesa) Create a file userFunctions.py: 1. Copy nameFormat(), createUser(), and printUser() from the problems above into the userFunctions.py file. 2. Modify nameFormat() to accept only two parameters first and last. Change last to an optional parameter. This function should now return either first or last, first. 3. Define a function printUsers() which accepts a list parameter users. This function calls the printUser function to print all user data.b) Create a separate file, functionModule.py: 1. Import all functions…
modify task6.c to create a tool that remove those files from the current working directory. You can use strstr() function to search for .bak, or .old in entry->d_name. Modify this program to clean up .bak .old files.*/ #include <stdio.h>#include <dirent.h>#include <string.h>#include <errno.h>#include <sys/types.h>#include <sys/stat.h>#include <unistd.h>#include <time.h> int main(int argc, char *argv[]){ if(argc!=1) return 1; char *path = "."; //current working directory DIR *dir = opendir(path); if(dir==NULL){ fprintf(stderr, "Cannot open dir %s: %s\n", path, strerror(errno)); return 1; } struct dirent *entry; while((entry=readdir(dir))!=NULL){ printf("%ld %s\n", entry->d_ino, entry->d_name); }
using c++ In this assignment you are going to implement your own version of university library system,Thesystem will have two different sides , the first one is to help the librarian to do his job and the other side for admin to manage every one permissions in the system , so You should provide the following features in your system: Admin view o Add/remove Studentso Add/remove librarian o Add/remove other admins Librarian viewo Add/Delete bookso Issue/Return bookso View bookso View Issued bookso Log in /log outo Search for the book(id/name) Simple backend for your system , You could use a file each row should represent itemo Books File should be something like:Id , Book Name, Author Name, Available quantity, Issued Quantity1,Oliver Twist, Charles Dickens,98,2In the previous the first row was the name of each column , you can do that or handle it in your code , id =1 , Book Name =Oliver Twist ..Etc. Tables neededo Books Id  Book Name Author Name Available quantity Issued…