The E. coli DNA molecule contains 4.70 x 105 base pairs. Determine the number of codons that can be present in this DNA molecule. number of codons: 1.57 X106 codons Assuming that the average protein in E. coli consists of a chain of 420 amino acids, calculate the maximum number of proteins that can be coded by an E. coli DNA molecule. number of proteins: proteins

The E. coli DNA molecule contains 4.70 x 105 base pairs. Determine the number of codons that can be present in this DNA molecule. number of codons: 1.57 X106 codons Assuming that the average protein in E. coli consists of a chain of 420 amino acids, calculate the maximum number of proteins that can be coded by an E. coli DNA molecule. number of proteins: proteins

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
How many comparisons are needed to count the number of duplicates in a list? How many comparisons are needed to find the maximum value in a list of numbers? How many unique length 3 codons coding amino acids can be made from the unique 4 nucleotides found in genes?
A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine base
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first cytosine base with guanine base b. Replacement of final thymine base with guanine base c. Replacement of second guanine base with cytosine base d. Replacement of first thymine base with adenine base
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first guanine base with cytosine base b. Replacement of first thymine base with cytosine base c. Replacement of second thymine base with adenine base d. Replacement of seond guanine base with adenine base
The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?