The figure at the right shows a partially drawn replication fork. a) Annotate this figure to show the proper location of each of the following: • template DNA strand polarity • DNA polymerase I • Topoisomerase (gyrase) leading strand daughter fragment(s) lagging strand daughter fragment(s) Single stranded binding proteins • DNA polymerase III • Primase • Ligase • Helicase

The figure at the right shows a partially drawn replication fork. a) Annotate this figure to show the proper location of each of the following: • template DNA strand polarity • DNA polymerase I • Topoisomerase (gyrase) leading strand daughter fragment(s) lagging strand daughter fragment(s) Single stranded binding proteins • DNA polymerase III • Primase • Ligase • Helicase

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece
Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Which of the following statements best describes why one of the daughter strands is synthesized in pieces? the enzymes that synthesize DNA are slower that the enzymes that unwind the double helix and this produces 'lagging time' the enzymes that synthesize DNA can only do so in a 5' --->3' direction this figure illustrates a eukaryotic cell since prokaryotic cells do not synthesize DNA…
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki fragments. The RNA primers have not yet been removed. A. Which Okazaki fragment was made first, the one on the left or the one on the right? B. Which RNA primer will be the first one to be removed by DNA polymerase I, the primer on the left or the primer on the right? For this primer to be removed by DNA polymerase I and for the gap to be filled in, is it necessary for the Okazaki fragment in the middle to have already been synthesized? Explain. C. Let’s consider how DNA ligase connects the left Okazaki fragment with the middle Okazaki fragment. After DNA polymerase I removes the middle RNA primer and fills in the gap with DNA, where does DNA ligase function? See the arrows on either side of the middle RNA primer. Is ligase needed at the left arrow, at the right arrow, or both?
For the template DNA below, which includes one labeled end of the template DNA, clearly label the following: The origin of replication The most recently added base on each strand you draw for b & c, marked with an asterisk (star). Where DNA helicase would be & direction it moves. Where DNA ligase will be needed after replication is complete.
When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative model
In eukaryotes, primers generated during DNA replication are made of _____________ and are removed by _____________. Group of answer choices RNA; 3'-->5' exonuclease activity of DNA polymerases RNA; 5'-->3' exonuclease activity of DNA polymerases DNA; 3'-->5' exonuclease activity of DNA polymerases RNA; ribonuclease enzymes DNA; 5'-->3' exonuclease activity of DNA polymerases DNA; ribonuclease enzymes
In Semi conservative replication: A. After one round of replication of a single molecule of DNA, one DNA molecule will be produced that contains two parental strands of DNA and one DNA molecule will be produced that contains two new (or de novo) strands. B. After one round of replication of a single molecule of DNA, two resulting DNA molecules will be produced both of which contain a mix of both parental and new DNA interspersed on every strand of DNA C. After two rounds of replication of a single molecule of DNA, two resulting DNA molecules will contain both a parental strand and a new strand of DNA and the other two resulting DNA molecules will contain all new (or de novo) DNA D. After two rounds of replication of a single molecule of DNA, one resulting DNA molecule will contain 2 parental strands of DNA and the other three resulting DNA molecules will contain all new (or de novo) DNA E. A and C F. B and D
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the above
If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)
A gene encoding one of the proteins involved in dna replication has been inactivated by a mutation in a cell. in the absence of this protein, the cell attempts to replicate its dna. What would happen during the dna replication process if each of the following proteins were missing?a. DNA polymerase B. DNA ligasec. Sliding clamp for DNA polymerased. nuclease that removes RNA primerse. DNA helicase F. primase