DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative

DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 5SQ

See similar textbooks

Related questions

Q: Every DNA sequence that can serve as an origin of replication is found to contain a DNA strand that…

A: The DNA double helix is unwrapped at precise locations termed origins, where replication begins.…

Q: DNA replication always proceeds in only one direction because the ________ of the incoming…

A: DNA replication is an important part of the cell cycle and it takes place in the S-phase of the cell…

Q: Draw a replication bubble with both replication forks and label the origin of replication, the…

Q: Between which types of compounds in a double-stranded DNA molecule must the bonds break before…

A: -DNA replication is the biologucal process of producing two identical replicas of DNA from one…

Q: Polymerase chain reaction is—   a reaction involving a chain of different types of polymerases…

A: PCR is a technique to make many copies of DNA in vitro. It relies on thermostable Taq polymerase and…

Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…

A: Replication is the synthesis of new DNA molecules from the parental DNA.

Q: In eukaryotic DNA replication, _________ unwinds the DNA at the replication fork. DNA gyrase…

A: Question - In eukaryotic DNA replication, _________ unwinds the DNA at the replication fork.…

Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA…

A: 1. The ligase enzyme joins two nucleotide molecules together during transcription. The answer is…

Q: DNA polymerase I has both a 5' to 3' exonuclease activity and a 3' to 5' exonuclease activity.…

A: DNA polymerase are enzymes needed for the replication of DNA

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: is DNA replication called semiconservative? A. Both daughter strands are entirely new B. Each…

A: Replication of DNA is very important for the transmission of chromosomal DNA from one generation to…

Q: Escherichia coli (E. coli) has one replication origin that contains specific genomic sequences…

A: DNA replication It is defined as the process through which the copying of DNA takes place in cells.…

Q: What factors promote the fidelity of replication during synthesis of the leading strand of DNA?…

A: DNA replication is a long drawn process that needs many enzymes and binding proteins to initiate,…

Q: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired…

A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…

Q: DNA polymerase III (the main polymerase) Helicase DNA ligase Single-stranded binding proteins DNA…

A: DNA replication is the process by which new DNA strands are produced from the old DNA strands by the…

Q: What is a replication fork?

A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…

Q: Leading strand Origin of replication Lagging strand Leading strand Lagging strand Overall directions…

A: Deoxyribonucleic acid or DNA is a molecule which comprises of two polynucleotide chains which wraps…

Q: 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label…

A: DNA (Deoxyribonucleic acid) replication refers to the process that forms two identical DNA strands…

Q: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired…

A: The process of creating a copy of DNA is referred to as DNA replication. In a eukaryotic cell, this…

Q: Why is DNA replication considered semiconservative? A. Both strands of each replicating DNA…

A: In DNA: Adenine pairs up with Thymine Cytosine pairs up with guanine

Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: During DNA replication, the function of RNA primers is to Group of answer choices serve as a…

A: DNA replication is the process by which two copies of DNA is produced from a parent DNA molecule. It…

Q: Why is DNA replication considered semiconservative? a. One molecule consists of the old strands…

A: DNA or Deoxyribonucleic acid is the hereditary material in humans and almost all other organisms. It…

Q: What is a true statement about the leading and lagging strands during DNA synthesis? The leading…

A: Ans : Correct statement for the above question is - The lagging strand is created due to DNA…

Q: his is responsible for breaking hydrogen bonds between complementary nucleotides of a DNA duplex…

A: Helicase is the enzyme responsible for breaking hydrogen bonds between complimentary nucleotides of…

Q: Draw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends…

A: DNA replication employs an outsized range of structural proteins and enzymes, each of that plays an…

Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: gyrase…

A: DNA is a genetic material that is a double stranded structure polymer of nucleotides. DNA…

Q: Which of the following is NOT a function of DNA polymerase III? Group of answer choices Exonuclease…

A: The main activity of DNA polymerase 3 is to add nucleotides to the short RNA primers. This is the…

Q: Describe the process of DNA replication as if explaining it to a fellow classmate. Imagine there is…

A: Introduction DNA replication is the biological process by which DNA makes a copy of itself during…

Q: Which of the following enzymes has a major role in joining of DNA fragments (Okasaki fragments)…

A: DNA gyrase - It is an bacterial bacterial enzyme that reduces the topological strain in ATP.…

Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank)

A: This question is based on the Dna replication.

Q: Why does DNA have a leading strand and a lagging strand during replication? Select the correct row…

A: Replication is the process of copying the DNA strands. It occurs through a series of events with…

Q: Given the replication events listed below which even takes place first Single Strand binding…

A: DNA replication is a semiconservative process meaning one strand act as a template on which new…

Q: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer…

A: Ligase unwinds the helical structure of DNA. Topoisomerase breaks the pressure of supercoiling in…

Q: Okazaki fragments are small pieces of DNA synthesized discontinuously on the lagging strand of DNA…

A: Introduction: DNA replication is semi-conservative. The double helix's individual strands serve as…

Q: In DNA replication, the fundamental reason that Okasaki fragments are produced is that Group of…

A: DNA replication is an important cellular mechanism by which two identical DNA copies are produced…

Q: Molecules involved in DNA replication A. DNA Polymerase I B. DNA Polymerase II C. Single strand…

A: DNA replication is the process that involves formation of new daughter DNA strand based upon the…

Q: Semiconservative replication: Progeny: Equilibrium density gradient centrifugation: Theta…

A: 1. Semi-conservative replication: It is the replication process in which a nucleic acid molecule…

Q: Describe the role of the proteins involved with DNA replication. Also identify if the protein is…

A: DNA Replication is a process to replicating the dsDNA to form multiple copies of it. DNA…

Q: Eukaryotic and bacterial DNA replication share many features, but eukaryotic DNA replication is more…

A: Eukaryotic organisms are defined as the organism having a definite nuclear membrane. But the…

Q: 1 2 3 4 5 6 7 8 9 The gaps between the DNA fragments are sealed by DNA ligase…

A: The DNA replication starts with the opening of two strands and then DNA polymerase binds elongates…

Q: Synthesis of which strand requires the repeated action of DNA ligase?

A: DNA replication is a biological process that involves producing two identical DNA replicas from a…

Q: DNA Repication Explanation (no ESSAY) Must include STEP BY STEP Leading strand with 5' and 3'…

A: The process of replicating a double-stranded DNA molecule into two similar DNA molecules is known as…

Q: In the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one…

A: In 1958, Matthew Meselson and Franklin Stahl performed an experiment which supported the DNA…

Q: Which of the following substances adds equivalent DNA nucleotides to the 3' end of Okazaki fragments…

A: DNA polymerase I

Q: Which of the following statements is/are TRUE for both replication and transcription? Polymerase…

A: DNA replication is the biological process of producing two identical copies of DNA from a double…

Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA…

A: Central dogma includes three main processes Replication, Transcription, and Translation.…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

DNA Replication Explanation Must Include (no essay)

Leading strand with 5' and 3'
Lagging strand with 3' and 5' - Okazaki fragments
Bases (following the base pairing rule)
Primase -Primer
helicase
Polymerase
Ligase
Parent Strands
Daughter Strands
New DNAs - semiconservative

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
DNA replication ATGGATCAGHTCCAGGGTACCCA what would the new strand look like
List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a replicationfork.
A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, write the sequence of the newly synthesized strand in the direction from left to right in which it will be synthesized.
Describe the process of DNA replication as if explaining it to a fellow classmate. Imagine there is an unlabelled diagram in front of you to guide your explanation. (Try to include as many relevant proteins and concepts as possible to help demonstrate an understanding, eg. DNA Helicase, Okazaki Fragments, etc).
DNA Repication Explanation (no ESSAY) Must include STEP BY STEP Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative
The structure of DNA requires both hydrogen bonds and phosphodiester bonds Explain the connection between phosphodiester bonds and DNA replication.
In DNA replication, the fundamental reason that Okasaki fragments are produced is that Group of answer choices DNA replication can proceed only in the 5’ to 3’ direction replication on the leading strand is slower than replication on the lagging strand DNA polymerase tends to slip while replicating the lagging strand DNA polymerase has to alternate between the leading and lagging strands during replication none of these are true.
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?