You are using these two plasmids to make a recombinant DNA molecule. You want to make a molecule, that has two origins of replication and is ampR but NOT kan, using only one fragment from each plasmid. How large, in base pairs, will be your desired recombinant DNA molecule? O 6087 base pairs O 5630 base pairs O 2659 base pairs 8746 base pairs

You are using these two plasmids to make a recombinant DNA molecule. You want to make a molecule, that has two origins of replication and is ampR but NOT kan, using only one fragment from each plasmid. How large, in base pairs, will be your desired recombinant DNA molecule? O 6087 base pairs O 5630 base pairs O 2659 base pairs 8746 base pairs

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony.When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. Withregard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrectpyrimidine instead of the correct pyrimidine (e. g. adding cytosine where thymine should be added) is called atransition. If a pyrimidine is incorrectly added to the growing strand instead of purine (e.g. adding cytosine when anadenine should be added), this type of mistake is called a transversion. If a transition or transversion is not detected by DNA polymerase, a mutation is created the permanently changes the DNA sequence. Though both types of mutations are rare, transition mutations are more frequent than transversion mutations. What are at least three explanations as to why this is the case?
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
Reiji and Tuneko Okazaki conducted a now classic experiment in1968 in which they discovered a population of short fragmentssynthesized during DNA replication. They introduced a shortpulse of 3H-thymidine into a culture of E. coli and extracted DNAfrom the cells at various intervals. In analyzing the DNA aftercentrifugation in denaturing gradients, they noticed that as theinterval between the time of 3H-thymidine introduction and thetime of centrifugation increased, the proportion of short strandsdecreased and more labeled DNA was found in larger strands.What would account for this observation?
The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be made in one round of DNA replication in a bacterial population containing 1000 bacteria?
Your book contains about 2 million characters (letters, spaces, and punctuation marks). If you could typewith the accuracy with which the prokaryote E. coli incorporates,proofreads, and repairs bases in replication (about one uncorrectederror in 109to 1010 bases), how many such books would you haveto type before an uncorrected error is “permitted”? (Assume thatthe error rate is one in 1010 bases.)
Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger sequencing minimize the length of replication since phosphodiester bonds are not forned during DNA replication. Also, does it differ from dNTPs functionally since it lacks two hydroxyl groups?
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
What type of repair would be used to fix a mutation that arises during replication and that escapes detection by polymerase proofreading mechanisms? What is the most likely reason that this mutation escaped correction during proofreading?
In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the above