You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con- taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blue and white), you are surprised to fi nd that the plasmid from the blue colony contains a very small insert of approximately 60 bp, while the plasmid from the white colony does not appear to contain any insert at all. Explain these results.

Q: The beta subunits of E.coli DNA polymerase III are responsible for its _______.   A. ribosome…

A: In prokaryotes, the DNA replication is carried out with the help of various enzymes, like, DNA…

Q: You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on…

A: Molecular cloning is a technique by which a gene of interest is inserted into a plasmid vector,…

Q: A plasmid is cleaved by restriction endonucleases and analyzed by agarose gel electrophoresis.…

A: From the agarose gel image, we get information about the plasmid size and the restriction sites…

Q: With the use of well-illustrated diagrams, reconstruct the entire cloning process by explaining…

A: Molecular cloning is a method that includes insertion of “recombinant DNA” into a “vector” (carrier…

Q: When a 5-kb circular plasmid is digested with a restriction enzyme that has three recognition sites…

A: The restriction enzymes are present in bacteria and in other prokaryotes. The restriction enzymes…

Q: etion enzyme Sall cuts the sequence GTCGAC to leave a five base, 5' overhang. The restriction enzyme…

A: A restriction enzyme is classified under the category of a protein. These are isolated from bacteria…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: (Note: According to given guidelines, we are supposed to answer only 3 subparts. Please repost other…

Q: You isolated a 10,500 base pair plasmid (supercoiled, cccDNA) from E. coli.  The plasmid contains…

A: Gel electrophoresis is a method for separating DNA fragments based on their size. An electric…

Q: A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves…

A: A plasmid is an extrachromosomal small DNA molecule present in a cell and is also physically…

Q: Write down the basepairs of double-stranded ONA that is generated at the joint between a plasmid…

A: Restriction enzymes are the enzymes which cut DNA at a specific location called as restriction site.

Q: Why is the presence of insertion sequences on the F plasmid significant? What are F- prime (or F')…

A: The process of fusion of two compatible bacterial cells, is known as Conjugation. It requires the…

Q: In Figure 10-10, determine approximately how manyBAC clones are needed to provide 1× coverage ofa.…

A: Bacterial Artificial Chromosomes are vectors derived from the F-plasmid of E.coli. They can maintain…

Q: arac PKAN-R 5,512 bp PARA 4,872 bp BamH PBAD Bam 377 bp kank ampR PBAD-rfp 807 bp Hindill Hindli

A: Answer :  The ristricton enzmye used to make cut in the plasmid.  Both the plasmid should be cut…

Q: A strain with the ability to conjugate is mixed with a recipient strain.  Recipients are noted to…

A: By the way the question is incomplete. There should be a fourth option as : RECEPIENT has recA gene…

Q: What do you mean by vector plasmid?

A: Bacteria can be defined as the single-celled microscopic organism which is cosmopolitan as it is…

Q: You are using these two plasmids to make a recombinant DNA molecule. You want to make a molecule,…

A: Recombinant technology includes the process in which we can introduce our gene of interest with a…

Q: 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would…

A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: Hey, I need help with this please: Plasmid pRIT450 is 7.0 kb in length and has single PstI, EcoRI,…

A: Given: A Plasmid pRIT450 of  7.0 kb in length. It has single PstI, EcoRI, and BamHI sites. The…

Q: Can you separate a plasmid from a non plasmid nucleic acid? How?

A: Plasmids are usually the circular, extrachromosomal DNA that has the ability of self replicating…

Q: A. Use this data to generate a circular map of the plasmid. Pst I: 10 kb Bam HI: 10 kb Sal I:…

A: Restriction endonucleases are enzymes that cut DNA at specific sites. Restriction endonucleases…

Q: Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated:…

A: A plasmid is determined as a very small and circular molecule of DNA, which is also double-stranded…

Q: A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic…

A:

Q: Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if…

A: Restriction enzyme are specific DNA cutters and extremely useful while exploring molecular biology…

Q: You are about to isolate a 3000 bp large plasmid from an E.coli culture. You know that the plasmid…

A: 1bp dsDNA=650 Dalton 1 Dalton=1.66×10^(-24) grams ng is nanograms mcl is micro liters 1 gram=…

Q: Write the process of, building a recombinant plasmid? Or how you can build a recombinant plasmid?

A: A plasmid is a circular, single-stranded DNA molecule that is distinct from a cell's chromosomal…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: DNA Plasmid -- A Plasmid is a small extra chromosomal DNA molecule which is physically separated…

Q: You are trying to clone you favorite piece of DNA into the PUC vector shown above. You've pulled an…

A: Joachim Messing and colleagues developed a variety of plasmid cloning vectors, including pUC19. The…

Q: You cut a plasmid with a restriction enzyme that cuts it into three pieces-one fragment is 280 base…

A: Plasmids are circular double stranded DNA. These are basically found in the unicellular organisms.…

Q: A plasmid comprised of B-DNA changed its linking number from 420 to 457, resulting in a superhelix…

A: Introduction: DNA in the cell must be arranged in order to allow the packing of large DNA molecules…

Q: Make a drawing of the double recombinant plasmid containing all four fragments. Label fragment…

A: There are various options for rejoining molecules when the pKAN and pAMP fragments are combined.…

Q: You transform 500 uL of cells with 2.5 ug of plasmid DNA, and then you take 100 uL and spread that…

A: Answer. Transformation efficiency Transformation efficiency is defined as the number of…

Q: A researcher has a Trp− auxotrophic strain of E. coliwith a mutation in a single gene. To identify…

A: An auxotrophic mutant refers to the strain having a mutation that does not allow the strain to…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: The plasmid map can be created by checking the individual band patterns and band patterns with a mix…

Q: You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI…

A: Introduction: Gel electrophoresis: The technique of separating DNA fragments as per their size is…

Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…

A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…

Q: A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic…

A: Biotechnology is the use of our understanding of biological processes to develop useful applications…

Q: You have two cell cultures, each containing a different plasmid. The first plasmid is -5kbp long and…

A: Cell culture is a process in which cells are grown outside their natural environment under…

Q: You have two samples you have to sequence: one is a cloned plasmid that you want to verify the…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run…

A: Restriction enzymes are special enzymes that are known as nucleotide scissors as their role in cells…

Q: You are about to isolate a 3000 bp large plasmid from an E.coli culture. You know that the plasmid…

A: Multiple questions asked. I will answer the first question as per guidelines. Please repost the…

Q: We make a 1:5 dilution of our 450 ng/ul PML104 plasmid, and then use 15 of the diluted sample in a…

A: Plasmid digestion refers to the digestion of plasmid using a restriction enzyme. Restriction enzymes…

Q: A strain with the ability to conjugate is mixed with a recipient strain.  Recipients are noted to…

A: Bacterial conjugation can be described as a means of bacterial horizontal gene transfer. It can also…

Q: + DNA Fragment with Human Gene Recombinant Plasmid Plasmid Vector Bacterial DNA Recombinant Plasmid…

A: Since there are multiple questions in this particular question I will answer the first one for you.…

Q: Besides plasmid, what other vectors could you use to amplify your gene of interest? Name THREE (3)…

A: A vector is any vehicle, often a virus or a plasmid that is used to ferry a desired DNA sequence…

Q: Below is shown a plasmid map from a recombinant DNA experiment you have performed. You inserted your…

A: Electrophoresis is a technique used to separate macromolecules like DNA, RNA, and proteins based on…

Q: We use a NanoDrop spectrophotometer to analyze plasmid DNA obtained from miniprep. What information…

A: Spectrophotometer is defined as an instrument where it is used to measure the concentration of the…

Q: You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…

A: A restriction endonuclease, also known as a restriction enzyme, is a bacterial enzyme that…

Q: You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on…

A: Introduction  Plasmid Vectors: these are like the artificial vehicle to deliver our gene of insert…

Q: 1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid…

A: PBR322 is a cloning vector which is widely used for cloning purposes. The map of PBR322 is given in…