The process of transcription starts at the +1 site, which is determined by the promoter. In prokaryotes, the +1 site is 10 nucleotides downstream of the promoter, and in eukaryotes, the +1 site is 25 nucleotides downstream of the promoter. Bacterial Genes start transcription by recognition of the promoter sequence (TATAAT) with the second T located at the -10 position, with the promoter on the nontemplate strand. 2. Using the double stranded bacterial sequence provided below: - Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT) strand and the template strand (T) - Identify the +1 transcription start site and label as +1 and draw a vertical line in the DNA sequence between -1 and +1. - Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific nucleotides that will be transcribed. - Transcribe the appropriate part of the DNA into mRNA. Indicate the 5' and 3' ends of the new MRNA. 5' GGCATGTАТААTGGCACCGTAGTCATGCCсGACGCATTTA 3' 3' CCGTACATATTACCGTGGCATCAGTACGGGCTGCGTAAAT 5'
The process of transcription starts at the +1 site, which is determined by the promoter. In prokaryotes, the +1 site is 10 nucleotides downstream of the promoter, and in eukaryotes, the +1 site is 25 nucleotides downstream of the promoter. Bacterial Genes start transcription by recognition of the promoter sequence (TATAAT) with the second T located at the -10 position, with the promoter on the nontemplate strand. 2. Using the double stranded bacterial sequence provided below: - Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT) strand and the template strand (T) - Identify the +1 transcription start site and label as +1 and draw a vertical line in the DNA sequence between -1 and +1. - Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific nucleotides that will be transcribed. - Transcribe the appropriate part of the DNA into mRNA. Indicate the 5' and 3' ends of the new MRNA. 5' GGCATGTАТААTGGCACCGTAGTCATGCCсGACGCATTTA 3' 3' CCGTACATATTACCGTGGCATCAGTACGGGCTGCGTAAAT 5'
Biology Today and Tomorrow without Physiology (MindTap Course List)
5th Edition
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cecie Starr, Christine Evers, Lisa Starr
Chapter7: Gene Expression And Control
Section: Chapter Questions
Problem 4CT
Related questions
Question
Do all
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 2 steps with 5 images
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning