The process of transcription starts at the +1 site, which is determined by the promoter. In prokaryotes, the +1 site is 10 nucleotides downstream of the promoter, and in eukaryotes, the +1 site is 25 nucleotides downstream of the promoter. Bacterial Genes start transcription by recognition of the promoter sequence (TATAAT) with the second T located at the -10 position, with the promoter on the nontemplate strand. 2. Using the double stranded bacterial sequence provided below: - Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT) strand and the template strand (T) - Identify the +1 transcription start site and label as +1 and draw a vertical line in the DNA sequence between -1 and +1. - Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific nucleotides that will be transcribed. - Transcribe the appropriate part of the DNA into mRNA. Indicate the 5' and 3' ends of the new MRNA. 5' GGCATGTАТААTGGCACCGTAGTCATGCCсGACGCATTTA 3' 3' CCGTACATATTACCGTGGCATCAGTACGGGCTGCGTAAAT 5'

The process of transcription starts at the +1 site, which is determined by the promoter. In prokaryotes, the +1 site is 10 nucleotides downstream of the promoter, and in eukaryotes, the +1 site is 25 nucleotides downstream of the promoter. Bacterial Genes start transcription by recognition of the promoter sequence (TATAAT) with the second T located at the -10 position, with the promoter on the nontemplate strand. 2. Using the double stranded bacterial sequence provided below: - Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT) strand and the template strand (T) - Identify the +1 transcription start site and label as +1 and draw a vertical line in the DNA sequence between -1 and +1. - Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific nucleotides that will be transcribed. - Transcribe the appropriate part of the DNA into mRNA. Indicate the 5' and 3' ends of the new MRNA. 5' GGCATGTАТААTGGCACCGTAGTCATGCCсGACGCATTTA 3' 3' CCGTACATATTACCGTGGCATCAGTACGGGCTGCGTAAAT 5'

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
The consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA–3′. The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription?
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT 1.The mutation would move the promoter away from consensus and reduce the level of transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would bind the promoter to the consensus and produce normal levels of transcription 4.The mutation would inhibit the promoter thereby inhibiting transcription
Which of the following processes is required for the initiation of transcription in bacteria? Select one: a. binding of sigma to the promoter region b. formation of a peptide bond in the elongating polypeptide chain c. formation of a phosphodiester bond in the elongating RNA strand d. binding of DNA polymerase to the promoter region
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?
Which of the following statements concerning the sequence of events involved in the initiation of transcription by E. coli RNA polymerase are correct? ( can bemore than one) A.)Initiation starts with a pyrimidine nucleotide triphosphate. B.)The sigma factor (σ) functions during initiation of transcription. C.)Initiation starts with a purine nucleotide triphosphate, which is destined to become the 5'-end of RNA. D.)Initiation starts with a purine nucleotide triphosphate, which is destined to become the 3'-end of RNA. E.)RNA polymerase binds to the DNA at a point approximately 35 bp upstream of the start of transcription, at a sequence TTGACA. F.)The sigma factor does not dissociate until RNA elongation is complete.
What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include the following terms: template strand, non-template strand, initiation, elongation, termination, promoter region, RNA polymerase, termination signal.
Shown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome. a) Indicate where on the diagram you would find the following for each gene: Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3) Transcription termination site (tts1, tts2, and tts3) Start codon (start1, start2, and start3) Stop codon (stop1, stop2, and stop3) Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis Be sure to indicate the component on the appropriate molecule (DNA or RNA).