The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription? Why?

The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription? Why?

Name: The consensus sequence for the –35 sequence of a bacterial promoter is
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA– 3′. The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

The consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA–3′. The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription?
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated in places where the mRNA folds back on itself to form a hairpin-looped structure like the one shown below. How do you think that this structure stops transcription?
For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF 2 B. eIF4 C. eIF5
Several examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
The following nucleotide sequences are located about 30 nucleotides upstream of the transcription start site of 6 different organisms GAGAGC ААСТАС TACAAC ACGAAA TCCTAA TACAAC a. What is the consensus sequence of the promoter region?
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?