The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce the sequence of amino acids this codes for. b Determine the sequence of bases in the coding strand of DNA from which this MRNA was transcribed. c Within a cell, state where the triplet codes, codons and anticodons are found.

The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce the sequence of amino acids this codes for. b Determine the sequence of bases in the coding strand of DNA from which this MRNA was transcribed. c Within a cell, state where the triplet codes, codons and anticodons are found.

Name: The sequence of bases in a sample ofMRNA was found to be:GGU,AAU,CCU,
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The sequence of bases in a sample ofMRNA was found to be:GGU,AAU,CCU,UUU,GUU,ACU,CAU,UGUa Deduce the sequence of amino acids thiscodes for.b Determine the sequence of bases in thecoding strand of DNA from which thisMRNA was transcribed.c Within a ce

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

After tmRNA releases an mRNA and aberrant polypeptide from a stuck ribosome, the resulting polypeptide will A) be translated B) be destroyed by a protease C) be inserted into the cell membrane D) be used to regulate gene expression
Describe the recognition process by whichthe tRNA for N-formylmethionine interacts with the portion ofmRNA that specifies the start of transcription.
Explain how an α helix in a transcription factor protein is able to function as a recognition helix.
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTT
This chapter describes different types of TEs, including insertionelements, simple transposons, LTR retrotransposons, and non-LTRretrotransposons. Which of these four types of TEs have the followingfeatures?A. Require reverse transcriptase to transposeB. Require transposase to transposeC. Are flanked by direct repeatsD. Have inverted repeats
Based on one strand of a certain segment of DNA with the sequence below, answer the following question: 3’-ATGGATCCCATC-5’ What must the primary amino acid sequence be (assuming that the above sequence does not require post-transcriptional modification)?
When an ncRNA functions as a decoy, ita. contains binding sites for many different proteins, therebypromoting the formation of a large complex.b. recognizes other ncRNAs and sequesters them, therebypreventing them from working.c. can alter its conformation, allowing it to switch betweenactive and inactivate conformations.d. may physically prevent or block a cellular process fromhappening.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Following is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the tRNAs that will be used for translating this mRNA segment? Group of answer choices a. CGA, AAA, GUU, and UUU b. ARG, LYS, VAL, and PHE c. GCU, UUU, CAA, and AAA d. Arg-Lys-Val-Phe e. GCT, TTT, CAA, and AAA
Provide the SIGNIFICANT differences between the following: 1. Regulation AFTER transcription mRNA processing miRNAs a. b. 2. Types of Genes Facultative Constitutive a. b.
a mutation in the gene encoding Dicer would most likely result in: A) a failure to break the H bonds holding the 2 strands of the siRNA together B) the inability to form H bonds betwen the siRNA and the complementary mRNA that it targets. C) the inability of the target mRNA to be cleaved upon H bonding with the siRNA D) a failure to produce siRNAs responsible for knocking down gene expression E) the failure to produce a dsRNA specific to your gene of interest