Rank the steps of protein production in the order in which they occur. (1 = occurs first, 10 = occurs last) Initiation factors bind the small ribosomal V[Choose] subunit which recognizes the Shine Dalgarno sequence in the MRNA 6. 4. Elongation factors escort the aminoacyl 9. TRNA to the vacant A site of the ribosome 1 3 MRNA is spliced in the spliceosome to 10 remove introns 7 N-formylMethionine tRNA recognizes the start codon and recruits the large ribosomal [ Choose] subunit Translocation moves the uncharged tRNA to the E site and the recently extended tRNA is moved from the A site to the P site [Choose ] DNA is transcribed into MRNA in the nucleus with the help of RNA polymerase [ Choose ] The newly formed polypeptide chain heads to the ER where it undergoes post- ( Choose ] translational modifications Transcription factors bind DNA and help initiate the process of transcription (Choose] Release factors recognize the stop codons and cause dissociation of the ribosome from (Choose]

Rank the steps of protein production in the order in which they occur. (1 = occurs first, 10 = occurs last) Initiation factors bind the small ribosomal V[Choose] subunit which recognizes the Shine Dalgarno sequence in the MRNA 6. 4. Elongation factors escort the aminoacyl 9. TRNA to the vacant A site of the ribosome 1 3 MRNA is spliced in the spliceosome to 10 remove introns 7 N-formylMethionine tRNA recognizes the start codon and recruits the large ribosomal [ Choose] subunit Translocation moves the uncharged tRNA to the E site and the recently extended tRNA is moved from the A site to the P site [Choose ] DNA is transcribed into MRNA in the nucleus with the help of RNA polymerase [ Choose ] The newly formed polypeptide chain heads to the ER where it undergoes post- ( Choose ] translational modifications Transcription factors bind DNA and help initiate the process of transcription (Choose] Release factors recognize the stop codons and cause dissociation of the ribosome from (Choose]

Name: Rank the steps of protein production in the order in which they occur
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Rank the steps of protein production in the order in which they occur. (1 = occurs first, 10 = occurslast)Initiation factors bind the small ribosomalsubunit which recognizes the ShineDalgarno sequence in the MRNAV[Choose]6.2Elongation factors escort

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 18RQ: A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence b) State the amino acid sequence of the polypeptide translated from this mRNA c) Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.