The structure below is a OH HN. R Sphingomyelin Phosphocholine ceramide Sphingolipid All are correct
Q: What are two functions of the hepatic portal system?
A: In the animal's circulatory system, there is presence of a portal venous system. This occurs when…
Q: Sample pH vs Initial Velocity (AA450/60 seconds) a bo16 0.0014 al0012 0.0008 0.0006 0.0004 0.0002 pH…
A: Enzymes are biological catalysts that are capable of catalysing a reaction by binding to Substrate.…
Q: What term describes the expression of gene products that are needed in consistent amounts all of the…
A: Gene expression is the process through which information from a gene is used to make a functioning…
Q: Key features of signal transduction mechanisms are: specificity, amplification, integration and…
A: Receptors are present in the body. The drug molecules are bound to such receptors and show their…
Q: Indicate at what step number in the glycolysis pathway the following event occur and why? a.…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: Which isotope did Hershey and Chase use to label the nucleic acid in bacteriophage T2
A: Alfred Hershey and Martha Chase experiments performed a series of experiments in 1952 which helped…
Q: Consider the typical beta oxidation of linoleic acid (C18:2 ^Δ9, 12): How many ATP are generated in…
A: 117 ATP
Q: How do you calculate RNA concentration?
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: H1. Estimate the TKN associated with a sample having 50 mg/L of cell tissue and 10 mg/L of ammonia.…
A: TKN (Total Kjeldahl Nitrogen) test is a method of estimation of total concentration of organic…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: Food is the source of macronutrients and micronutrients required for the body. During the process of…
Q: Explain the Glycolysis and Kreb’s Cycle metabolic pathways.
A: Metabolic pathways in biochemistry are series of chemical reactions takes place which are linked…
Q: (osgnthesis
A: Retrosynthesis is a breaking down of targeting molecule by the process of ''breaking down '' a…
Q: What role does superoxide dismutase play in ameliorating the effects of reactive oxygen species?…
A: Superoxide dismutase: This is a very important Enzyme that protects the living cells from harmful…
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: In contrast to resting cells, muscle tissue in an active metabolic state will have ___________…
A: Muscles are referred to as the source of contact addresses of the body that are principally…
Q: Patient who had undergone a complex maxillofacial operation could not take food during 2 days, but…
A: Introduction: The level of blood glucose monitoring gives us insight into the effectiveness of the…
Q: Assessment : Short Quiz True or False Polarity of water is due to the more electronegative hydrogen…
A: Water is a universal polar solvent. The molecular formula of water is H2O. It is composed of two…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: value the cathode or anode). Protein eins wards Pepsin Lysozyme Hemoglobin Mynolohin IpH 1.0 11.0…
A: On basis of the gel used, electrophoresis is classified into 2 types, Agarose gel…
Q: CH,0--o CH;0-P-O ČH-OH C=O Ó. 10-C-H H-C-OH H-C-OH O C-H ČH;O-P-0 H-C-OH O CH-O
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: BACKGROUND A 2-year-old black girl is being seen by the hematologist after her pediatrician found…
A: Due to the lack of mitochondria, there is no TCA cycle occurring in the RBCs. So, RBCs obtain the…
Q: 6. Which of the following is an example for broad substrate specificity? a) Chymotrypsin hydrolyzing…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Phospholipids have ____ fatty acids while triglycerides _____ fatty acids.
A: Lipids are defined as organic substances insoluble in water but soluble in organic solvents like…
Q: Retroviral delivery of the gene coding for Combined Immunodeficiency. treats individuals with Severe…
A: Successful gene therapy that is performed with the retroviral vectors neceserily requires robust…
Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…
A: A three letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid.
Q: What is the possible drug interaction in the following structure of phenoxybenamine?
A: Phenoxybenamine is a haloalkylamine drug which is used to treat hypertension. Haloalkylamines does…
Q: Which of the following statements describes one reason that plant oils are generally healthier for…
A: Plant oils, or vegetable oils, are derived from plant sources. There are three different types of…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: An antagonist is a particular drug that blocks opioids by attaching to the specific opioid receptors…
Q: A single gene mutation causing several, and seeming unrelated problems is called Entropy Pleiotropy…
A: The diseases that are caused due to single gene mutation are known as single gene disorders.
Q: Lipids may originate through carbocation-based condensation of thioesters or by carbanion-based…
A: Lipids are a class of compounds that are insoluble in water and soluble in non-polar solvents.…
Q: SMC proteins participate in DNA bending that contributes to folding and condensation. True False
A: SMC is expanded as Structural Maintenance of Chromosomes. SMC complexes are the ones that represent…
Q: Why picric and tannic acid is used for the treatments of burn. Explain this in the concept of…
A: Tannic acid and picric acids are phenolic compounds. These are water-soluble compounds…
Q: In which type of segregation, genetic information is gained? Alternate Adjacent Both None
A: Principle of Segregation genes explains how pairs of gene variants are separated into reproductive…
Q: Pyruvate can be processed under anaerobic conditions to ethanol (in yeast) or to lactate (in…
A: Introduction: Pyruvate is the product of glycolysis which is an important junction point in…
Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond…
A: The αα-helix is an ordered secondary conformation of proteins. An αα-helix is stabilized by the…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a.…
A: Glycolysis is a metabolism of glucose (six carbon molecule) into three carbon molecule (pyruvate)…
Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond donor…
A: The α-helix is an ordered secondary conformation of proteins. An α-helix is stabilized by the…
Q: How will you prepare 750 ml of the digestion buffer. Show all steps and calculations and remember to…
A: Digestion buffers are used to digest or break open the cells. It is composed of buffering salt…
Q: If you had measured the absorbances of your unknown in test tubes that were half the diameter of the…
A: Proteins are composed of twenty standard amino acids that are attached together via peptide bonds.…
Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…
A: Two answers are correct
Q: What LAB species will you utilize in the fermentation process?
A: '' Since you have asked multiple question, we will solve the first question for you. If you want…
Q: 1) Given the structure of pyruvate below, draw the reaction with NADH to form lactate. (only the…
A: Pyruvate is the end product of the glycolytic pathway. Under aerobic condition, the pyruvate…
Q: 1. Search for a journal article about a certain drug that targets (whether stimulate or block) a…
A: a) Cystic Fibrosis is a genetic disorder caused by mutations in the gene encoding for CFTR i.e…
Q: Rf Sample values A 0.21 В 0.39 C 0.33 0.27 Four amino acid samples were subjected to a normal-phase…
A: Normal phase chromatography is a type of adsorption chromatography which is used for analysis of…
Q: In own words, give 5 or more reasons why most of the clinical features of the diseases…
A: Mitochondria are an essential component of eukaryotic cells, and their failure has been linked to a…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Q: Name FOUR polymers in your body right
A: Polymers are composed of many monomers attached together via covalent bonds. Polymers are made up of…
Q: When using blunt-end primers, how would you determine the correct plasmid construct from the…
A: Ligation is the joining or ligation of two nucleic acid fragments through the action of a ligase…
Q: Glucose is phosphorylated to glucose-6-phosphate by hexokinase in the first step of the glycolytic…
A: Reactions that have a positive value of Delta G are not favorable in nature. Hence in order to…
Step by step
Solved in 2 steps
- The most non-polar part of a typical phosphatidylcholine molecule would have to be:A. the fatty acid groupB. the trimethylamine groupC. the glycerol groupD. the phosphate groupE. the choline groupPhosphatidylcholine is the only major phospholipid in the plasma membrane. true falseWhich of these is not a component of phosphatidylcholine? a) glycerol b) phosphate c) choline d) sphingosine
- Flippases help maintain membrane asymmetry. True Falseplease answer with explanation and use text format as much as possible do not copy, thanks Draw structures of the following. If anything is unsaturated write in configuration only! - Palmitic acid - Arachidonic acid - Phosphatidylcholine - Trilauric acidWhich of the following is not a phospholipase?a) Ab) Cc) Dd) K
- In which of the following glycerophospholipids two phosphatidic acids share a single glycerol?a) Cardiolipinb) Phosphatidylserinec) Phosphatidylinositold) PhosphatidylcholineMatch the structures a mixed triglyceride a mineralocorticoid steroid hormone a weakly amphipathic molecule that modulates membrane fluidity prostanoic acid as the parent compoundTetrodotoxin is a neurotoxin found in puffer fish. This large molecule blocks the sodium channels in neurons. Infer the effect tetrodotoxin would have on the passing of an action potential in a neuron.
- All are protiens of cell membrane that are involved in flow of nerve impulse except 1-channel proteins 2-carrier protiens 3-peripheral protiens 4-integral protiens Also give explanationSome cells with very negative resting membrane potentials, like -80 mV, express an the inward rectifier K+ channel. Describe the channel/ conductance.Endothelins are 21-amino acid vasoconstricting peptides produced primarily in the endothelium. They have an important role in vascular homeostasis. Endothelin activates G protein-coupled receptors (GPCRs) ETA or ETB on a target cell. Which subunit of heterotrimeric G protein is released when the receptor is activated? a.) gamme b.) beta c.) alpha
