The tac promoter, an artificial promoter made from portions of the trp and lacUV5 promoters, has been introduced into a plasmid. It is a hybrid of the lac and trp (tryptophan) promoters, containing the −35 region of one and the −10 region of the other. This promoter directs transcription initiation more efficiently than either the trp or lac promoters. Why?

The tac promoter, an artificial promoter made from portions of the trp and lacUV5 promoters, has been introduced into a plasmid. It is a hybrid of the lac and trp (tryptophan) promoters, containing the −35 region of one and the −10 region of the other. This promoter directs transcription initiation more efficiently than either the trp or lac promoters. Why?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Which of the following statements concerning the sequence of events involved in the initiation of transcription by E. coli RNA polymerase are correct? ( can bemore than one) A.)Initiation starts with a pyrimidine nucleotide triphosphate. B.)The sigma factor (σ) functions during initiation of transcription. C.)Initiation starts with a purine nucleotide triphosphate, which is destined to become the 5'-end of RNA. D.)Initiation starts with a purine nucleotide triphosphate, which is destined to become the 3'-end of RNA. E.)RNA polymerase binds to the DNA at a point approximately 35 bp upstream of the start of transcription, at a sequence TTGACA. F.)The sigma factor does not dissociate until RNA elongation is complete.
What part of the E.coli RNA polymerase specifically binds to the -10 and -35 region of an E.coli promoter?
How do you think that transcription randomizes positions of nucleosomes and repression restores the ordering after transcription? How might you test to see if there was an exchange of histone subunits during transcription or if the nucleosome is truly transferred as a single unit? Would you expect the DNA band representing the distance from the restriction enzyme site to the hypersensitive site to be a single band or a smear? Defend your answer.
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
A particular mutation in the bacterial sigma factor allows this protein to bind RNA polymerase but prevents it from coming off (detaching) RNA polymerase once it binds. What specific effect will this mutation have on transcription? It will prevent the transcription termination exerted by the Rho protein. It will prevent the formation of closed complexes between RNA polymerase and the promoter. It will prevent the formation of open complexes between RNA polymerase and the promoter. It will prevent the transition from the transcription initiation to the transcription elongation stage. It will prevent the synthesis of abortive RNA transcripts while the RNA polymerase is bound at the promoter.
The consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA–3′. The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription?
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
You design a guide RNA to target your gene of interest, which you will express attached to a scaffold RNA. You transform cells with Cas9, the guide+scaffold RNA, and an HDR template. The HDR template codes for the insertion of a premature stop codon located 10 bp upstream of the Cas9 cut site, a base pair substitution 15 bp upstream of the Cas9 cut site, and a base pair substitution in the PAM sequence. Question: Is this scenario “possible” or “not possible”? Cas9 cuts the target site, the stop codon and the two base pair substitutions are introduced.
You design a guide RNA to target your gene of interest, which you will express attached to a scaffold RNA. You transform cells with Cas9, the guide+scaffold RNA, and an HDR template. The HDR template codes for the insertion of a premature stop codon located 10 bp upstream of the Cas9 cut site, a base pair substitution 15 bp upstream of the Cas9 cut site, and a base pair substitution in the PAM sequence. Question: Is this scenario “possible” or “not possible”? Cas9 cuts the target gene sequence at a site 3 bp downstream of a PAM site Explain your reasoning as to why.
The sigma factor protein's role in transcription in E. coli includes which of the following? None of the answer options are correct. plays a role in transcription termination forms part of the core enzyme required for transcription initiation helps the siRNA to bind to the promoter All of the answer options are correct. contributes to the proof-reading activity of RNA polymerase And The role of tRNA is to serve as an intermediate in the decoding of genes. serve as general translational components of the ribosome. facilitate protein trafficking in protein secretion. facilitate splicing of pre-messenger RNAs. act as vehicles bringing amino acids to the site of protein synthesis. None of the answer choices are correct.
Bacterial DNA containing an operon encoding three enzymes is introduced into chromosomal DNA in yeast (a eukaryote) in such a way that it is properly flanked by a promoter and a transcriptional terminator. The bacterial DNA is transcribed and the RNA correctly processed, but only the protein nearest the promoter is produced. Can you suggest why?