The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA transcript that would be made in this region? Group of answer choices 5' AUGCGCUAGCUG 3' 5' CAGUAGCGCAU 3' 5' UACGCGAUCGAC 3' 5' CAGCTAGCGCAT 3' 5' ATGCGCTAGCTG 3'

The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA transcript that would be made in this region? Group of answer choices 5' AUGCGCUAGCUG 3' 5' CAGUAGCGCAU 3' 5' UACGCGAUCGAC 3' 5' CAGCTAGCGCAT 3' 5' ATGCGCTAGCTG 3'

Name: The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA transcript that would be made in this region?Group of answer choices5' AUGCGCUAGCUG 3'5' CAGUAGCGCAU 3'5' UACGCGAUCGAC 3'5' CAGCTAGCGCAT 3'5' ATGCGCTAGCTG 3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthA in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthT in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Q) Find the initiation and stop codons in this mRNA?
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter)