There are two broad classes of transposons. Each class is characterized by its method of "jumping" (either through an RNA intermediate or via excision and insertion) True False Most mutations of evolutionary significance are A)induced B)spontaneous..

There are two broad classes of transposons. Each class is characterized by its method of "jumping" (either through an RNA intermediate or via excision and insertion) True False Most mutations of evolutionary significance are A)induced B)spontaneous..

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 11QP: Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome...

See similar textbooks

Related questions

Q: Discuss the significance of chromosomes in terms of their information content.

A: Introduction The chromatin fibre is present as in the most uncondensed form packaged in the nucleus...

Q: Fermentation permits the continued extraction of energy from glucose in the absence of oxygen. If gl...

A: Ferment is derived from the Latin word fervent. The verb fervert means "to boil." Louis Pasteur was ...

Q: Q1 The Hardy-Weinberg equation calculates the frequencies of different genotypes from the frequency ...

A: Hardy–Weinberg's principle It proposes that in a population, allele and frequencies of genotype will...

Q: 9. Two nutrient solutions are maintained at the same pH. Actively respiring mitochondria are isolate...

A: The cellular respiration is responsible for the breakdown of glucose and production of energy in the...

Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...

A: The correct option is C.

Q: Describe the purpose of cell cycle checkpoints.

A: Introduction The cell cycle is controlled by various internal and external factors such as the amou...

Q: Identify the statement below that is the MOST TRUE O All personality traits are equally heritable.

A: Personality traits are those which we acquire during our lifetime.

Q: Explain why some—but not all—of an organism's genesare expressed

A: Only a fraction of genes are expressed at a given time. Gene expression is important for cell divisi...

Q: Oxygen is required for the mitochondria to produce ATP. True

Q: 1. How are you going to perform compatibility testing/crossmatching in the following special cases? ...

A: Introduction:- Blood compatibility test is used in laboratories to determine if a particular unit o...

Q: Ronald was the victim of an assault and has symptoms of posttraumatic stress disorder as well as dep...

A: The diagnosis of the disease is very important in medical science. It helps in proper treatment and ...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: How you think the needs of societies in the past differ from what we need today. How can the differ...

A: Society is getting changed at a fast speed nowadays. Some changes in society are acceptable. while s...

Q: c)NaCl? My reasoning behind this is because molecules under 100 Da can use simple diffusion, while n...

A: Diffusion is the passage of molecules from high concentration towards low concentration. In a cell ...

Q: Referring to the genetic code (the codon usage table), what would be the amino acid sequence of the ...

A: Mutations are a sudden, heritable change in the DNA sequence that alters the amino acid sequence whi...

Q: close relative of this flower has very large sepals compared to this one. Apply what you know about...

A: Introduction For the specification of four whorls of floral organ, three classes i.e A, B, C, ...

Q: If you notice on your agar plate that there are more than one color of colonies-- What does this mea...

A: A bacterial colony is what you Called a set of bacteria derived from the same mother cell. which mea...

Q: Edmontosaur description

A: Edmontosaurus is a genus of hadrosaurid dinosaur. It contains two known species: Edmontosaurus regal...

Q: Use an example to describe tumor suppressors

A: Cancer is the state of uncontrolled cell division that has some genetic factors.

Q: What are the differences of dogs from other kingdoms?

A: Identification : Whittaker proposes 5 kingdom classification based upon cell structure, organizati...

Q: Plants use the proton electrochemical gradient across the vacuole membrane to power the accumulation...

A: Plant cells have vacuoles that accumulate excess salts and water.

Q: Homeotic gene expression _______. a. occurs via bacterial operons b. maps out the overall body plan ...

A: These are the genes which helps in the development of anatomical structures. Types of Gene Regulatio...

Q: Chimpanzees, bonobos, and orangutans cannot speak like us because A: They are too stupid. B: Their a...

A: Speech is a communication that is used to express our thoughts in words.

Q: Onions leaves have been modified for the purpose of _______ Defense (protection from predators) Sto...

A: ✓The scales of the onion bulb are actually modified leaves that provide protection from water loss(i...

Q: Determine which of the following passages are arguments. For those that are, identify the conclusio...

A: Note- As we are allowed to answer only one question at a time. I will provide answer for only first ...

Q: Name and describe the idea that explains how mitochondria and chloroplasts are thought to have origi...

A: Photosynthesis is the process through which green plants and some organisms use sunshine to convert ...

Q: What are the typical reactions observed when incubating lactic acid bacteria in litmus milk?

A: Because it includes the milk protein casein, the sugar lactose, vitamins, minerals, and water, milk ...

Q: Biochemical Molecular analysis of the bela glo Saudi sickle 3. Describe the effect of thelamino acid...

A: Introduction :- Amino acids are the building blocks of any polypeptide or protein structure . The se...

Q: Can a monohybrid cross be used to illustrate Mendel’s principle of independent assortment?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: Match the rodent ovulatory cycle phase with the correct hormone combination Proestrus x Peak Progest...

A: The term menstrual cycle is associated with the occurrence of cyclic ovarian activities in mammals. ...

Q: 4. If the malaria parasite is eradicated from an area where it used to be prevalent, what expect to ...

A: Introduction :- Malaria a disease which is caused by the plasmodium protozoan , for example :- plasm...

Q: How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples...

A: In normal cells the processes like cell division and differentiation are highly controlled and coord...

Q: Snapdragon flowers can come in red, white, and pink. This trait is controlled by a single locus gene...

A: According to Mendelian law of dominance, one of the two alleles associated with a particular phenoty...

Q: Which part of the claim consists of the patient portion of the CMS-1500 and what information does it...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: The...

Q: Provide eight morphological endemic species from the Philippines.

A: *Endemic Species means the species of plants or animals which are found in a particular region or ...

Q: 1. Reports about a man who successfully undergone xenotransplantation of a pig heart in replacement ...

A: Introduction :- Transplantation is method or process by which the cells , tissues , organs are trans...

Q: Do you think the scar would look better (i.e. the wound heal "better") if friend #2 underwent hyperb...

A: This is because the scars of Tb never heals, it cannot be reversed under any circumstances, even whe...

Q: Problem 1. A male black (BB) and polled (PP) Angus is crossed with a female black (BB) and horned (p...

A: Problem1 We have, cross between a male black and polled Angus (BBPP) with a female black and horned ...

Q: Homologous chromosomes_____ . a. are inherited from two parents b. are sister chromatids c. are diff...

A: Chromosomes are the structures that become visible during cell division only.

Q: How does photosynthesis transform solar energy into the chemical energy of sugar molecules? Match th...

A: Photosynthesis is making energy-rich molecules like glucose, in the presence of green pigment Chloro...

Q: . A 20-year-old woman collapses at a wild party several hours after taking ecstasy. Which one of the...

A: Ecstacy is a psychoactive drug, meaning consumption of it has an effect on the functions of brain. I...

Q: If you were an epidemiologist interviewing someone with an infectious disease that could lead to an ...

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the beginn...

Q: Sdve this response. Question 1 Which of the following can cause evolution? Select all that apply. OA...

A: Evolution is change in characteristics of a species over successive generations. The idea of evoluti...

Q: Under ideal conditions, prokaryotes are capable of reproducing at a(n) ______ rate

A: Archaea and bacteria produce their offsprings by asexual reproduction, usually by binary fission. Ge...

Q: Herpes Simplex Virus 1

A: Herpes simplex virus is a common virus that causes infections of the skin and mucous membranes. It c...

Q: The drug butenamide blocks the co-transporters for Na+ and Cl- in the ascending limb of the loop of ...

A: The drug butenamide is a loop diuretic whose main function is to block the Na+ k+ 2cl- co transport...

Q: Name 4 different evolutionary adaptations that allowed plants to survive on land instead of in water...

A: Plants are phototrophic organisms that contain chlorophyll and perform photosynthesis which produce ...

Q: 1. What is/are the importance of testing Rh blood type in the laboratory? 2. Why is Rh system deter...

A: The Rh blood group is discovered by the Wiener and landsteiner.This Blood group system is based upon...

Q: Cytoplasm of a plant cell divides by the process of_____ . a. telekinesis c. fission b. nuclear divi...

A: Introduction Cytoplasm is a viscous liquid that fills each cell and is surrounded by the cell membra...

Q: 1. Centrioles are only found in cells. They function in cell They have protein fibers. Draw a pictur...

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answ...

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

There are two broad classes of transposons. Each class is characterized by its method of "jumping" (either through an RNA intermediate or via excision and insertion)

True

False

Most mutations of evolutionary significance are

A)induced

B)spontaneous..

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

It has been noted that most transposons in humans and other organisms are located in noncoding regions of the genome regions such as introns, pseudogenes, and stretches of particular types of repetitive DNA. There are several ways to interpret this observation. Describe two possible interpretations. Which interpretation do you favor? Why?
Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that can beidentified rapidly by inverse _______
Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.
What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?
Nearly _______of the Human GenomeConsists of Transposable Elements?
What fraction of the human genome consists of transposons and retrotransposons?
A certain compound that is an analog of the base cytosinecan become incorporated into DNA. It normally hydrogen bonds just as cytosine does, but it quite often isomerizes to a form that hydrogen bonds as thymine does. Doyou expect this compound to be mutagenic, and, if so,what types of changes might it induce at the DNA level?
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)
While characterizing a mutation in a gene of interest, you discover that the mutation involves an insertion within the coding sequence of the gene. You suspect that the inserted sequence is a transposon and would like to determine which of the three major transposon families it belongs to. What sequence elements could be looked for within the inserted sequence that would help place it in one of the three families?
From Table 20-3, would you expect the noncoding mutation g4205a to be fixed before or after the coding mutation G238S in a population of bacteria evolving resistance to the antibiotic cefotaxime? Give at least tworeasons for your answer.
On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?
Suppose a 10-year old patient has come to your office with a very rare disease. One so rare that only 100 people for the past 100 years have been diagnosed and nobody knows the gene or genes that are mutated in this disease. Describe the gene sequencing toold you would use to identify the mutated gene or genes in this hypothetical disease.