There is another melanocyte-stimulating hormone called B-melanotropin. Cleavage of 3-melanotropin with trypsin produces the following peptides plus free aspartic acid. WGSPPK, DSGPYK, MEHFR Part A If you assume maximum sequence similarity between a-melanotropin and 3-melanotropin, then what must the sequence of the latter be? (a -melanotropin: Ser- Tyr- Ser-Met- Glu- His- Phe- Arg- Trp- Gly- Lys- Pro- Val) Drag the appropriate labels to their respective targets so that the maximum sequence similarity to the order of a-melanotropin will be shown. MEHFR WGSPPK DSGPYK Reset Help
Q: Order the compounds made of the following molecules by increasing melting point. molecule melting…
A: There are four types of biological macromolecule: proteins, nucleic acids, lipids and…
Q: How can molecular structural analysis be accomplished with electrospray ionization mass…
A: Molecular structural analysis involves determining the arrangement and properties of atoms within a…
Q: When transaminated, the three branched-chain amino acids (valine, leucine, and isoleucine) form…
A: Maple syrup urine disease is caused by a deficiency in the branched-chain α-keto acid dehydrogenase…
Q: The Michaelis-Menten equation is often used to describe the kinetic characteristics of an…
A: Vmax is defined as the maximum reaction velocity at which all enzymes become saturated with…
Q: From the peptide chain: Met-Tyr-Phe-Arg-Ile-Glu-Asn-Asp-Ser, draw the structure of the product…
A: There are four types of biological macromolecules: proteins, nucleic acids, lipids and…
Q: Identify the type of base and sugar group present in each nucleotide or nucleoside.
A: Nucleotides serve as the basic building blocks for DNA and RNA. Nucleotides comprise a sugar…
Q: c) Draw a diagram of amylose in solution
A: Starch is a polysaccharide composed of glucose units joined by α-1,4 glycosidic bonds. It is the…
Q: Using a biochemical technique called site-directed mutagenesis, it is possible to substitute a…
A: Site-directed mutagenesis is a method employed in the lab to perform accurate and deliberate…
Q: V, (μmol-min-¹) 0.35 1/V₂ 0.3 0.25 0.2 0.15 0.1 0.05 0 0 50 100 150 200 250 300 350 400 450 [S] (nm)…
A: Michaelis Menten kinetics and Lineweaver Burk plot show the activity of the enzyme catalyzed…
Q: Match each SERCA domain to its role in Ca2+ transport: Drag and drop options on the right-hand side…
A: SERCA is an enzyme that is essential for muscular function. It is in responsible of transporting…
Q: Which specific carbohydrate has the following characteristics: 1) Most abundant monosaccharide in…
A: Carbohydrate is a class of organic compounds found in living tissues and foods as starch, cellulose,…
Q: Analyze the following pair of compounds. Which of the terms explains the relationship between the…
A:
Q: 2. Assuming no contact inhibition and optimal nutrient and waste transport, graph the cell…
A: a. The cell proliferation rate (kp) is a measure of how quickly cells divide. A high kp value means…
Q: the half life of metformin ( Glucophage) is 17.6 hours. What is the rate of decay?
A: A substance's half-life is the amount of time it requires for half of it to degrade or change into a…
Q: An intermediate folding stage seen in protein denaturation or renaturation is called?
A: Proteins exist in four levels of molecular conformations in a human body: primary, secondary,…
Q: All of the following statements about amino acid metabolism in humans are true except: The process…
A: The complex series of metabolic processes in the body that involve the synthesis and breakdown of…
Q: One way of expressing the rate at which an enzyme can catalyze a reaction is to state its turnover…
A: Turnover number of an enzyme is defined as the number of substrate molecules converted into its…
Q: HB is a poor transporter of oxygen OHB is an efficient transporter of oxygen HB is an efficient…
A: Hemoglobin is a pigment which is present in red blood cells. It is made up of 4 polypeptide chains…
Q: he Lineweaver-Burk plot, which illustrates the reciprocal of the reaction rate (1/v) versus the…
A:
Q: For each fatty acid: [1] How many molecules of acetyl COA are formed from complete catabolism? [2]…
A: Beta-oxidation is a cyclic process by which fatty acids are broken down into their acetyl-CoA…
Q: What metabolic pathways are aerobic and which are anaerobic? What are the advantages and…
A: A living organism's total chemical reactions are referred to as its metabolism. It incorporates…
Q: This drug resembles proteins that are cut by enzymes that use water to break amide linkages in…
A: Enzymes are biological catalysts that increase rate of biochemical reactions.Enzymes are mostly…
Q: An enzyme can organize substrates to be nearby in such a way where the local/nearby concentration of…
A: Catatalysis is a phenomenon in which the rate of reaction is altered with the help of a substance…
Q: Order the following substances with the most acidic at the top and the most basic (or alkaline) at…
A: To order the substances from most acidic to most basic, we can use the concept of pH, where lower pH…
Q: The dominant motif found in hemoglobin and myoglobin is: a) twisted beta sheet b) beta barrel c)…
A: 1)The dominant motif found in hemoglobin and myoglobin is (b) beta barrel.2)myoglobin consists of (d…
Q: The phrase "dietary amino acids are absorbed during digestion" is used to describe when: Amino acids…
A: Amino acids combine to form proteins. Proteins and amino acids are the building blocks of life.…
Q: Highlight the atoms or groups that are in hydrophobic portions of this molecule in blue, and the…
A: The name of above given structure is 2-methyl pentanal
Q: Which of the following statements are true about the relationships of [S], KM, and Vmax? (Choose…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: You're examining an amino acid at position 3 in an alpha helix. Without knowing the specific amino…
A: Amino acids are the building blocks of proteins and play essential roles in various biological…
Q: how did you detremine the ln(2)?
A: The concept of 'ln' is nothing but simple mathematics. We can simply type - 'ln 2' in a calculator…
Q: complete the sentence. In the Sanger method, the carbon atom of the reagent fluorodinitrobenzene…
A: The Sanger reagent (1-fluoro-2,4-dinitrobenzene) is used to determine the N-terminal amino acid in…
Q: A tetrapeptide was analyzed with carboxypeptidase, the results from the analysis are found in the…
A: There are four classes of biological macromolecules- proteins, nucleic acids, lipoproteins and…
Q: Can waxes undergo hydrogenation reaction, why or why not?
A: Hydrogenation reaction converts unsaturated bonds such as carbon-carbon double bond or carbon-carbon…
Q: Н H₂N-C-COOH CH2 CH2 CH₂ M OW Oc
A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…
Q: This is an image of double stranded DNA. Which red label in the above diagram is closest to the 5'…
A: DNA or the Deoxyribonucleic acids serves as the ge immaterial of almost all biological organisms…
Q: Decide whether each of the following statements is true about chitin deacetylase. It tremendously…
A: Chitin deacetylase is an enzyme found in a wide range of microorganisms, including fungi and…
Q: 7. Draw a diagram of the heme complexes in deoxyhemoglobin and oxyhemoglobin (complete porphyrin…
A: A heme complex is a critical molecular structure found in various biological molecules, such as…
Q: Solve the Michaelis-Menten equation for KM when vo=Vmax/2. What does this tell you about the…
A: Enzymes catalyse biochemical reactions by lowering their activation energy.Enzymes have their…
Q: be the A form of DNA, the B form of DNA, the Z form of DNA, or all three. A form the favored form of…
A: DNA called deoxyribonucleic acid is made up of nucleotides. Each nucleotide is nade up of a -…
Q: Why is the citric acid cycle the central pathway in metabolism? (Select all that apply.) Citric acid…
A: The citric acid cycle, sometimes referred to as the Krebs cycle, is an important metabolic process…
Q: Succinylcholine is a fast-acting, short-duration muscle relaxant. Doctors use the chemical before…
A: Succinylcholine chloride is a short-acting depolarizing neuromuscular blocker, to be used in…
Q: cum NH₂ GLP-1 (i) receptor H. (ii) GLP-1 N-teminus HN NH R CH3 (iii)
A: The amino acids in the N terminus are:Ala (8)His (7)Ser (2)Alanine is found at position 8 in the…
Q: How does Foldit Protein Folding Game use puzzles like Design, De Novo, Revisiting, help in…
A: The Department of Biochemistry and the Center for Game Science at the University of Washington…
Q: Please help!!!! For all subparts, will provide surely good ratings.
A: The dipeptide ME is explained as the combination of two amino acids viz., Methionine (Met) and…
Q: If a cell were given glucose labeled at carbon-3 with 14C, what carbon(s) of pyruvate would contain…
A: Glycolysis is a process by which a cell converts one glucose molecule to 2 molecules of pyruvate.…
Q: Previously Protein A and 5mM of ligand X were combined in a neutral solution and 36% of Protein A…
A: In this scenario, we are comparing how Protein A interacts with ligand X under two different…
Q: The protein fragments ABS1 and ABS2 of tropomodulin were produced as fusion proteins with chitin…
A: It is possible to filter proteins or fragments of proteins which have been fused with a…
Q: Draw the most acidic forms of the following peptides: a. ELVIS b. LIVES c. Approximate the pI of…
A: The four types of biological macromolecules are proteins, nucleic acids, lipids and…
Q: 1) Describe the importance of the amino acids in the structure such as the alpha helix in the…
A: Proteins have four levels of organisation. They are - primary, secondary, tertiary and…
Q: Protease enzymes cleave proteins by hydrolyzing peptide bonds. The strategy for each type of…
A: Protein digestion and regulation are greatly aided by proteases, sometimes referred to as peptidases…
52.17
Step by step
Solved in 3 steps with 2 images
- There is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin with trypsin produces the following peptidesplus free aspartic acid. WGSPPK DSGPYK MEHFRIf you assume maximum sequence similarity between α-melanotropin andβ-melanotropin, then what must the sequence of the latter be?What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid, leucine, andphenylalanine? Use the three-letter abbreviations to express youranswer.A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?A heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A). When the heptapeptide was treated with chymotrypsin, three peptides were produced: CT1 (K,,Y, G), CT2 (F,A, V), and CT3 (D). The sequences of these peptides is not known, however. When the peptide was treated with Sanger’s Reagent and hydrolyzed, DNP-K and DNP-A were recovered. What is the amino acid sequence of the heptapeptide?
- What is the expected molecular weight of the protein encoded by the sequence provided here: ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGTGATGTGAGTCTGGGCTGAWhat are the sequences of all the possible tripeptides that contain the amino acids aspartic acid, leucine, and phenylalanine? Use the threeletter abbreviations to express your answer.A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
- Consider the following peptide: Lys-His-Asp-Glu-Phe-Cys-Ala-Asp-His-Arg What is the net charge of this peptide at pH = 1? What is the net charge of this peptide at pH = 14?What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-Draw a peptide for cys-asn- pro-gly (Using the same format in picture)