Q: Because of the constant exchange of blood calcium and bone calcium, the concentration of calcium…
A: The calcium concentration in the blood is tightly regulated because of the importance of calcium for…
Q: Reproduction is usually secual with both male and female sexes, however asexual reproduction does…
A: Parthenogenesis is the type of asexual reproduction involving the development of female gametes…
Q: Temperature-dependent sex determination (TSD) is the method of sex determination in sea turtles. In…
A: The answer to this question is solved in serial wise. A) Cellular Events
Q: You are given the following carbohydrates: glucose, maltose, sucrose, and starch. Explain the…
A: Carbohydrates are found in both healthy and unhealthy foods—bread, beans, milk, popcorn, potatoes,…
Q: Give two vegetative and two floral differences between grasses and sedges
A: Grasses are the member of family Poaceae and sedges are the member of family Cyperaceae. Both shows…
Q: 9. For stabilization of disturbed brain functions in mental disease nootropic agents are widely used…
A:
Q: Jim’s jaundice is caused by the accumulation of bilirubin in his blood and tissues. What is the…
A: Jaundice Jaundice is the yellow discoloration of sclera ,skin and mucous. it is a characteristic of…
Q: Suppose an environment in which vegetation respiration accounts for 10% of GPP and the energy in…
A: * Ecosystem ia a place where plants and animals and othe organisms interact together to form life. *…
Q: Which of the following muscles did he use?
A: Muscles are soft tissues. Many stretchy fibers make up muscles. Different types of muscles have…
Q: What is true of linked genes? Choose all that apply: pts deducted for including incorrect answers…
A: Linkage explains why some traits are typically passed down in families. Because the genes for hair…
Q: Define pulse.
A: Pulse is a medical terminology used to address the process of regular expansion of an artery.
Q: differentiate founder effect from bottleneck effect
A:
Q: As shown in Figure 13-14, what is the fundamental distinction between a pair-rule gene and a…
A: A pair-rule gene is a type of gene that plays a role in the creation of insect fragmented embryos.…
Q: how many tetrads are present in a primary spermatocyte undergoing synapsis? a. 23 b. 44 c. 22
A: Meiosis division is a kind of cell division that results in the formation of haploid sex…
Q: Are there any safety concerns with teaching a cat in this way?
A: Learning is defined as any relatively permanent change in behaviour that occurs as a result of…
Q: What is gene targeting? Give some examples of gene targeting?
A: Gene is a stretch of DNA in a chromosome which codes for a functional product either in the form of…
Q: METABOLIC METABOLITES DISORDERS Alkaptonuria SYMPTOMS DIAGNOSIS Phenylketonuria Gout Ketosis Fatty…
A: Liver is the largest digestive gland of the body it contains several enzymes to control and regulate…
Q: Explain how the diameter of skeletal muscle fibers varies and what type of muscle tissue grows as…
A: A single muscle cell is made up of muscular fibres. They help in the control of the body's physical…
Q: Splicing regulatory (SR) proteins bind at exon to recruit U1snRNP and U2 snRNP during RNA splicing.…
A: There are few important points about splicing apparatus are as follows: The central component of…
Q: Adaptive Immunity Briefly describe the adaptive immune response to Canine Parvovirus .
A: Adaptive immunity is likewise referred to as acquired immunity or particular immunity and is only…
Q: Which of the following is NOT true for proto-oncogenes? O cause a gain in function O mutations are…
A: Proto-oncogenes are those genes that under normal conditions help the cell to grow but when they are…
Q: skeletal muscle is packed with myofibrils consisting of a repeating chain of contractile units we…
A: Sarcomere shortens and then the muscle contract. Sarcomere is considered as the smallest unit of…
Q: before each nutrient can be absorbed it is broken down into its smallest component. What are the…
A: The food contains three macronutrients that require digestion before they can be absorbed. The three…
Q: Ras Is a kinase enzyme that can attach a phosphate group to MAPKKK during signal transduction in a…
A: Mitogen-Activated Protein Kinases are specific to threonine and serine amino acids which further aid…
Q: What parasite (genus and species) do you suspect? What is the life stage for the parasite…
A: Maria is complaining of diarrhea, gastrointestinal pain, and bleeding.
Q: An antimicrobial agent shows selective toxicity when specifically: An antimicrobial agent is said to…
A: Bacteria, viruses, and other microorganisms are everywhere in the environment. They are even inside…
Q: Describe the important characteristics of gymnosperms?
A: Gymnosperms are distinguished by the following important characteristics:
Q: How can be Palawan bearcat commonly known as Palawan binturong or asian bearcats speciated?
A: The binturong (Arctictis binturong) is a medium-sized mammal, also known as a bearcat, of the…
Q: In a population at genetic equilibrium, the frequency of the dominant phenotype is 0.96. What are…
A: Introduction :- The condition of an allele or genotype in a gene pool (such as a population) in…
Q: Describe the trend/pattern in the frequency of M as the population undergoes the following:
A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: How SBS methods are useful for human genomes ?
A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…
Q: all of the following that are true regarding viruses? Oncogenic viruses stimulate uncontrolled host…
A: All that are true regarding viruses - Answer - 1. Oncogenic viruses stimulate uncontrolled host…
Q: One type of epithelial tissue can convert into another under certain abnormal conditions. Give two…
A: Introduction :- The epithelium is a type of body tissue that forms the covering on all of your…
Q: Why is the epithelial tissue characterized as polar sheets? answer and explain
A: INTRODUCTION Tissues are the groups of cells that perform a particular or similar function in the…
Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…
A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…
Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Identify the benefits and risks of Genetically Modified Organisms
A: Genetical Modified Organisms in Plants Genetical modified plants is nothing but modifying the DNA of…
Q: Which of the following structures is found ONLY in the medulla of the kidney Group of answer choices…
A: NEPHRON Each kidney has nearly one million complex tubular structures called nephrons which are…
Q: Which of the following enzymes do not require a DNA template for nucleotide synthesis? *
A: DNA template is a DNA strand which is copied in to a complementary strand of DNA. According to the…
Q: If your footprint is greater than 1.72 hectares, outline a plan to reduce your footprint.
A: Ecological Footprint: A person's or a community's environmental footprint, measured in terms of the…
Q: Subject: Biopharmaceutical technology 1.Identify the types of water that are available and widely…
A: USP (US Pharmacopeia) is a designation that ensures that the water is purified and can be used in…
Q: 7. Sulfonamides are used to treat bacterial infections. Why these medicines do possess antibacterial…
A: As Guidelines you are not allowed to answer more than three sub quotation at a time please ask rest…
Q: These are the closest relative of an organism or a group of organisms Twin taxon Homologous taxon…
A: Introduction Taxonomy is the science of naming, describing, and classifying organisms, in a broad…
Q: The most important piece of evidence missing from Darwin’s original hypothesis was:
A: There are some points about Darwinism : Provided evidence for scientific theory that all species…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which functions as genetic material in most…
Q: Why are urinary tract infections such common healthcare-associated infections? Conduct additional…
A: Answer
Q: Define about dideoxynucleotides (abbreviated ddNTPs) ?
A: The genome of an organism is defined as the entire genetic information that is passed down from…
Q: 4. You are looking at a series of rock layers and you want to survey the youngest stratum. How will…
A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna…
Q: Match the chemotherapeutic agents with their use, side effects etc. Pareo. Match chemotherapeutic…
A: As per Bartleby policy i can solve only first three parts dear student.
Think of at least 1 way on how to lower the birth rate in the Philippines.
Discuss briefly.
Step by step
Solved in 2 steps
- Calculate incidence rate ratio comparing the three groups (1. Never used hormonal contraception, 2. Used hormonal contraception >6 month previously and 3. Any hormonal contraception). Use the Never used hormonal contraception group as a reference and use the age-adjusted incidence rates in Table 2. [DO NOT USE THE NUMBERS IN COLUMN 2 AND 3]Explain 5 importance or benefits of traditional birth attendant to the healthcare delivery system in Ghana.1- Why are teen pregnancies particularly at risk? 2- How many births are there in Canada each year? How many of these are at risk due to the mother's poor health and malnutrition?
- Propose a program in for a school or community that will raise theawareness of the students and will help them have an idea about the risks of teenage pregnancy.Choose one (1) drug used for women’s health (hormonal contraceptive, promote fertility, for menopause) and apply the 10 R’s to medication. Template below.Suggest the aspects of reproductive health which need to be given special attention in the present scenario.
- The reasons for high maternal and newborn mortality rate in the Philippines are: a. Delay in deciding to seek medical care, delay in identifying and reaching appropriate facility and delay in receiving adequate care b. All of the choices c. Delay in seeking medical care, delay in postpartum period, and delay in newborn care d. Delay in menstruation, delay in prenatal check up and delay in labor and deliveryMake a Health Education Plan about the filipino common myths, beliefs and practices regarding pregnancy, labor and delivery.After reading this week’s materials and the articles, related to birth control and Brazil, describe the methods of population control used in Brazil. Considering our collective responsibility for our planet now and in the future, explain the role that government should play in population control. Should governments get to decide how many children a person should have? Share your thoughts on this question and blend in how beliefs, religion, tradition, culture, or other factors might play a part in the final decision.
- Calculate incidence rate difference comparing the four categories of Any hormonal contraception (<1 yr, 1 to <5 yr, 5 to 10 yr, >10 yr) and Never used hormonal contraception. Use the Never used hormonal contraception group as a reference and use the age-adjusted incidence ratesExplain the advanatges and disadvantages of savior baby therapy and what are the three main ethical concerns ?List and briefly describe three different types of assisted reproductive technology that might be utilized by a couple who wants to have a child but has fertility problems. (Keep it to three paragraphs please)
