This specialized channel proteins facilitates water transport through osmosis. Spectrins Aquaporins

Q: Anatomically, the motor endplate potential is characterized by synaptic boutons active zones O…

A: Motor endplate-The specialized postsynaptic area of a muscle cell(myocyte). The motor endplate lies…

Q: QUESTION 4 In Mendel's pea plants, round shape (R) is dominant to wrinkled shape (r), and yellow…

A: Introduction :  Punnet Squares are square-shaped diagrams used to predict genotypes in breeding or…

Q: You accidentally used safranin as the primary stain and malachite green as the counter stain during…

A: Note: Since you have posted multiple questions so we will be solving the first one for you. As per…

Q: What is the general composition of lysosomes? How are they formed? How do they obtain low pH? Why is…

A: Lysosomes are cell organelles found in the eukaryotic cells of animals. In plants, these are very…

Q: Which of these options is NOT an example of a hypothesis that supports the occurrence of ecological…

A: The manner in which the way of means of  in which new species turn out to be an end result of…

Q: How do organisms with less complex systems such as those in protozoans are able to respond to…

A: Introduction Stimuli are detectable change in the internal or external environment.  which causes a…

Q: A prokaryotic cell _______ contain lysosomes. A prokaryotic cell _______ contain golgi. Select one:…

A: Prokaryotic cell The cell is the fundamental , structural and functional unit of living organisms.…

Q: Link each term with the correct definition.

A: Evolution is the gradual change in the inherited traits of natural populations over many…

Q: Briefly explain how protein breaks down in the body How do enzymes affect the proteins that we ate?…

A: Enzyme The protein molecules which act as catalyst in biological reactions.

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: A trait is a characteristic feature that is unique to particular individual . Each trait is…

Q: Cell swelling will most directly affect which type of channel protein? Group of answer choices…

A: Cell swelling is an change that occurs in acute cell injury and It may be a simply disappear as the…

Q: In which portions of the upright test tube do Paramecium tend to aggregate. Explain. What is…

A: Single-celled protists known as paramecium or paramecia can be found in watery areas in the wild.…

Q: On average, how many mutations different are we from our parents? O only 1 or 2 O 10-30 O 40-50 O…

A: Mutations are the changes in DNA sequence. Based on the location of the mutation, it can be silent…

Q: 1. A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by gel electrophoresis. The…

A: The restriction endonucleus are specific enzymes that are responsible for cutting phosphoruster bond…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: 70203 52000 CHIRAGRA SPIDER CONCH Harpago chiragra Linnaeus 1758 49+0

A: Introduction Characteristics of Mollusca are- 1. They are triploblastic. 2. They are bilaterally…

Q: 4. There are two principles underlying gel electrophoresis: charge, and the use of a gel matrix.…

A: As per our guidelines we are supposed to answer only ? One question ( if there are multiple…

Q: Which of these activities, that results in energy expenditure, makes up the greater portion of…

A: Introduction  In the body, energy is used in a variety of ways. To carry out vital tasks such…

Q: You are constructing a phylogeny of a hypothetical group of insects. Several of the ingroup species…

A: Introduction  The study of relationships among distinct groupings of species is known as phylogeny.…

Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…

A: Genes are the hereditary units that control specific traits, different versions of these genes are…

Q: Three risk factors of cancer.

A: Introduction  A group of diseases known as cancer involve abnormal cell proliferation and have the…

Q: What is the systems that depend on vesicular transport

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Traits can be described as quantitative or qualitative. Are only quantitative traits polygenic?…

A: As per our guidelines we are not allowed to answer more than one question at a time please ask next…

Q: What is a wet mount technique in microscopy?

A: Microscopy is the technical field of using microscopes to view samples and objects that the naked…

Q: If two different organisms are closely related evolutionarily, then they will (a) be similar in…

A: Any accumulated or cumulative change in an organism's or population's features over a long period of…

Q: Using cable theory to describe axon conduction would tell us a. the larger the diameter of the axon…

A: In an ion cascades, action potentials move along neuronal axons. Transmembrane pathways near the…

Q: 4 lines of evidence for evolution are presented (population, gene pool, allele…

A: Population:  According to the biological species concept "a group of potentially interbreeding…

Q: Almost all birds starved during the dry season depicted here. What type of selection would have been…

A: Due to different selective environment pressure, the gene pool composition changes, and this is…

Q: Q1: What would the white-fur-pigment allele frequency be if three of the homozygous black allele…

A: Allele pairings are categorised using the words homozygous and heterozygous. Homozygous individuals…

Q: (1) What does BLAST stand for? Explain the function of BLAST.

A: Information about bioinformatics is derived through computer analyses of biological data. In…

Q: What are the symptoms, cause, treatment, complications, impact of the life style of Gallstones…

A: Gallstones disorder:- it is disorder of gall bladder in which stone formed, hence it's name…

Q: 3 Allele distributions in Generation 1: 36 homozygous dominant individuals 13 heterozygous…

A: Given  p+q = 1  p2 + 2pq + q2 = 1 q = 0.4

Q: Which word best describes the image illustrated? P m tetrad staphylococcus Opalisades…

A: Bacteria They are prokaryotic unicellular organism which may be beneficial or harmful to human being…

Q: How do organisms with less complex systems such as those in protozoans are able to respond to…

A: Introduction: Stimuli is the  a detectable change in the internal or external environment.  which…

Q: Bob says that he is healthy and has no genetic diseases such as hemophilia or down syndrome.…

A: Genetics is the branch of Biology which deals with the study of genes and heredity. Haemophilia or…

Q: Channel gating – Carrier-mediated transport

A: Channel Gating :  It is defined as the  process of encoding of biological signals as a change in…

Q: Which ( somatic or gametes) are made in the process of meiosis?

A: Cell cycle is a series of events that are responsible for producing daughter cells from parent cell.…

Q: Many obese patients are part of a family in which all, or the majority, of it's members are obese.…

A: Genes are information/ trait encoding units present in the genome or DNA of organisms. These genes…

Q: Explain Darwin's Theory of Natural Selection using these terms: exponential rate of increase,…

A: Charles Darwin, the author of 'Origin of Species was a born naturalist. He is known for the most…

Q: For some kinds of experiments, biologists use isolated cells grown in culture. Cells differ…

A: Doubling time is the time taken for cells to complete one cell division. It varies for each…

Q: NaCl (a salt) can disrupt protein structure. This is true because a protein containing the amino…

A: Glutamic acid is an amino acid that is used in the formation of proteins. It is converted to…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: Introduction The phylogenytic tree represent the relationship between different organisms and also…

Q: The body/mass index (BMI) uses ____ to assess weight range. a. Waist circumference b. Height and…

A: Body mass index (BMI) measures body size. It is determined by knowing the weight in kilograms and…

Q: What is the primary structure of a protein?  Describe how the primary structure of proteins is used…

A: A protein is a naturally occurring, extremely complex substance made up of amino acid residues…

Q: Antibiotics are medicines that are used to fight bacterial infections. These medicines kill…

A: The prokaryotic cells are considered to be ancestors of the eukaryotic. The prokaryotic cell nucleus…

Q: Please answer all the questions A Half-life of a hormone is a.the length of time it takes to…

A: The study of chemical reactions that take place within and relate to live beings is known as…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenytic tree represent the relationship between different organisms and also gives us idea…

Q: Construct a cladogram from the data below.

A: A cladogram is also termed "phylograms", these are used to infer the relationship between different…

Q: Weight loss increases the plasma concentration of organochlorides in the blood.  Organochlorides…

A: During exercise, our muscles burn ingested food for energy and contract in response to a flood of…

Q: QUESTION 3 In Mendel's pea plants, round shape (R) is dominant to wrinkled shape (r), and yellow…

A: The inventor of modern genetics, an Austrian monk named Gregor Mendel, developed his rules of…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.