c) (bye (2vModule 7: Genetics at the Molecular Level: DNA and RNA at WorkUnit C: AssignmensT7.A small section of bacterial enzyme has the amino acid sequence arginine,-threonine, alanine, and isoleucine.The TRNA anticodons for the amino acid sequence shown above isA. GCA UGA CGA UACB. UCU UGG CGC UAUC. UCG UGU CGU UAGD. GCG UGC CCC UAA

Protein synthesis or translation process takes place on the ribosomes with the help of messenger RNA…

Answered: threonine, alanine, and isoleucine. The…

threonine, alanine, and isoleucine. The TRNA anticodons for the amino acid sequence shown above is A. GCA UGA CGA UAC B. UCU UGG CGC UAU C. UCG UGU CGU UAG D. GCG UGC CCC UAA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Related questions

Q: The android body type typically presents with body fat in a "pear shape". True False We are…

Q: Why is it important for a cancer cell to undergo phenotypic changes to be able to metastasize to…

A: Cancer is a devastating disease as these types of cells are very hard to kill by the body's own…

Q: What is heterospory? Briefly comment on its significance. Give two examples.

A: Introduction In this question we will discuss about heterospory.

Q: Hypothetically the yellow color of a lovebird is a dominant allele (Y). The male lovebird is orange,…

A: Dominant refers to the relationship between the two versions of a gene. Individuals receive two…

Q: A heterozygous pea plant of both traits is crossed with a recessive pea plant of both traits. What…

A: 1. Heterozygous for both the traits: WwYy 2. Recessive plant: wwyy The gamets are 1. WY, wy, Wy,…

Q: ASTIGMATISM usually causes HEADACHE .A true .B false

Q: How does climate change cause the ecosystem to become unstable? Include pollution in your answer

A: Drastic change in climate is leading the ecosystem to become very unstable. The details is discussed…

Q: 1. Explain how a "keystone species" and a "dominant species" are different.

A: Please follow step 2 for a detailed explanation.

Q: What are the difficulties that you would face in classification of animals, if common fundamental…

A: The classification of living organisms is based on the consideration of fundamental characteristics…

Q: What is the Leaf Economic Spectrum in different taxa?

A: In biology, taxa can be defined as a group of on or more populations of an organism. This represents…

Q: What are some examples of secretory cells?

A: Secretory cells- These cells are tall columnar cells which contains secretory granules in their…

Q: Which statement best describes how information is transmitted from molecule to molecule in ALL…

Q: In human pedigrees, an unknown sex is denoted by O Circle Square Rhombus None of the above

A: A pedigree shows connections between family and demonstrates which people have specific genetic…

Q: The protein hormone insulin which is secreted from pancreatic beta cells undergoes folding into…

A: The protein translation occurs in the cytoplasm of the cell. The proteins are then folded into their…

Q: DNA glycosylase inhibitors are used to study which DNA repair mechanism?

A: DNA glycosylase inhibitors are used to which DNA repair mechanism?

Q: Alignment of protein sequences from the HOX gene family identifies a highly conserved domain in the…

A: *Alignment of protein sequences from the HOX gene family identifies a highly conserved domain in the…

Q: Post-translational modifications of proteins include all the following EXCEPT a) alteration to the…

A: Translation is a process in which the RNA is translated into protein.Post translational modification…

Q: At which enzyme concentration does all of the available substrate react with the enzyme?

Q: Match the terms 1Genome surrounded by a protein coat 2Functional viral particle capable to infect a…

A: Match the terms :- Terms :- Answers

Q: 2. Describe the colonial characteristics of a lactose-positive, sucrose-positive, lysine…

A: 2. Describe the colonial characteristics of a lactose-positive, sucrose-positive, lysine…

Q: Explain the process that is depicted by the diagram below. (What is the overall purpose of the…

A: The Krebs cycle, also known as the citric acid cycle or the tricarboxylic acid cycle (TCA), is one…

Q: In the secondary immune response, naïve B cells are inhibited. Explain the molecular mechanism…

A: Antigen recognition by Ig receptors and extracellular signaling by CD4+ T cells (thymus-dependent)…

Q: What was the smallest voltage required to produce the maximum (largest) CAP? What proportion of the…

A: CAP is the Compound Action Potential which is the sum of all action potentials that occur in a nerve…

Q: NADH produced in glycolysis is transported to the mitochondria where the electron is transferred to…

A: * Glycolysis is the metabolic pathway that consists of sequence of ten reactions catalyzed by…

Q: 2 Produce antibodies Something that causes an allergy 3 Molecules on the cell that recognize…

A: INTRODUCTION The immune system of the body fights external particles that may cause diseases. The…

Q: Give two reality images of pig heart ( the frontal and transverse sections from the dissection)…

A: Answer

Q: Once the populations are separated evolution can occur through multiple mechanisms. Natural…

A: What kind of geographic barriers would have led to the finch speciation in the Galapagos.

Q: What is the predicted phenotypic ratio for the offspring of the following cross? Allele phenotypes:…

A: Given R - red (dominant) r - white (recessive) T - thin leaf (dominant) t - broad leaf…

Q: Name and briefly describe the 5 steps of mitosis and cytokinesis. Be specific

A: Mitosis :- Meiosis is the type of cellular division in which two daughter cells are formed and each…

Q: How do the rough endoplasmic reticulum and the Golgi apparatus act in the production and releasing…

A: The endoplasmic reticulum (ER) is the eukaryotic cell's transportation network, as well as a host of…

Q: Mary, a sever in a local café stays home from work for a few days with a case of what appears to be…

A: As mary has several symptoms we should know about the disease. Let's have an introduction to the…

Q: Define the following terms: (a) Aestivation (b) Placentation (c) Actinomorphic

A: (a) Predictions and projections The term 'aestivation' refers to the manner in which sepals or…

Q: 1. Explain how a "keystone species" and a "dominant species" are different .

A: Species: A population or population of individuals who have similar features and are capable of…

Q: Let’s say there is an organism with two pairs of alleles, W/w and Z/z, each pair is located on a…

A: Cell is the basic structural and functional unit of life. Group of cells is known as tissue.

Q: QUESTION 21 Which one gives the cellular location and the cellular function of the cystic fibrosis…

A: CFTR i.e cystic fibrosis transmembrane conductance regulator is a protein that is encoded by the…

Q: (ii) Which one of the following is non- biodegradable? A. DDT B. Vegetable peel C. Cardboard D. Bark…

A: The question is MCQ. It is asking about the non biodegradable object among the four options.

Q: What is nature inspired carbon materials? Describe the synthesis of corn-cob derived carbon from the…

A: * polluted carbon emissions can converted into green fuels without any wasted energy. *Methods for…

Q: List at least 5 parasites and indicate each their respective common names. How do you correctly…

A: THE SCIENTIFIC NAME HAS TWO PARTS GENUS NAME SPECIES NAME GENUS NAME: WRITTEN FIRST SHOULD BE…

Q: maintaining healthy weight as simple as eating less and exercising more?

A: Eating less and exercising more is a myth for maintaining healthy weight. Eating less and exercising…

Q: Which has the highest coefficient of digestibility? Carbohydrates Lipids Sugar…

A: The correct option is D. Proteins

Q: A protein is going to be associated with the cytosolic leaflet of the plasma membrane. This protein…

A: All cells are covered by an external membrane called plasma membrane which is also known as cellular…

Q: Transgenic animals used to produce insulin today are Saccharomyces cerevisiae Carthamus tinctorius O…

A: Introduction Transgenic animals:- These are animals in which there has been a deliberate…

Q: 10. Is the trachea in front of or behind the esophagus in pigs?

A: The oesophagus is a tube that transfers food from the mouth to the stomach. The meal is pushed…

Q: Compare the following situations of seed germination of monggo seeds within five days: - watered…

A: Germination is a process of sprouting of seed, or reproductive part of a plant body after a dormancy…

Q: Which of the following are true of interferons? Select all that apply. O They are a critical part of…

A: In the inflammatory response to infections, interferons (IFNs) are proteins produced by a number of…

Q: A claim of indirect infringement can occur even without an act of direct infringement. True O False

A: Infringement A prohibited act of violation with respect to patented invention without the…

Q: How can you tell a male pig from a female pig externally? Oral Cavity 3. What do the hard and soft…

A: Answer 1 :- Male and female pig can be differentiated based on the opening of the urogenital sinus.…

Q: In what cases would total length not be totally revealing about the length of a fish – can you think…

A: The length of the fish can be measured as follows: - Total length: - It is the length of the fish…

Q: The genotype of a green pea is unknown. It is crossed with a recessive yellow pea. The results are…

A: A test cross is an experimental cross of an individual organism of dominant phenotype but unknown…

Q: Identify the variation of gametes from the genotype Bb Ll?

A: Gametes are the haploid cells. They are produced by the process of meiosis.

Question

c) (by
e (2v
Module 7: Genetics at the Molecular Level: DNA and RNA at Work
Unit C: AssignmensT
7.
A small section of bacterial enzyme has the amino acid sequence arginine,
-
threonine, alanine, and isoleucine.
The TRNA anticodons for the amino acid sequence shown above is
A. GCA UGA CGA UAC
B. UCU UGG CGC UAU
C. UCG UGU CGU UAG
D. GCG UGC CCC UAA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Three different bacteria species have the following consensus sequences upstream of a conserved gene. Species A Species B Species C -10 TAATAAT TTTAAT TATATT -35 TTGACA TTGGCC TTGAAA Table 15.2 Order the bacteria from most to least efficient initiation of gene transcription. A > B > C B > C > A C > B > A A > C > B
A set of cells that host various DNA fragments collectively representing an organisms entire set of genetic information is a _________. a. genome b. clone c. genomic library d. GMO
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ C) Write out the sequence of the normal beta-globin protein (as much as you can given the above info and below genetic code table) and indicate what would be different in the mutant protein. Don't forget your ends!
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
With this gene provided: MuPKS c.1949 C>T (p.R644W) Please provide the following; 1. Name of the gene 2. Location of the nucleotide change 3. Nucleotides that are changed 4. Type of mutation 5. Amino acid change 6. Location of the amino acid change