Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 10TYK
A part of an mRNA molecule with the sequence 5’-UGC GCA-3’ is being translated by a ribosome. The following activated tRNA molecules are available.
tRNA Anticodon Amino Acid
3’-GGC-5’ Proline
3’-CGU-5’ Alanine
3’-UGC-5’ Treonine
3’-CCG-5’ Glycine
3’-ACG-5’ Cysteine
3’-CGC-5’ Alanine
Which two of them can bind correctly to the mRNA so that a dipeptide can form?
a. cysteine–alanine
b. proline–cysteine
c. glycine–cysteine
d. alanine–alanine
e. threonine–glycine
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time by activated tRNA molecules is; *
A. 2
B. 3
C. 4
D. 5
Which is a characteristics of the normal genetic code? *
A. one codon can code for only one amino acid
B. one amino acid can have only one codon
C. one tRNA molecule can bind to only one codon
D. one aminoacyl-tRNA synthetase can react with only one tRNA
Which of the following describes the effect of a point mutation on amino acid identity in a protein? *
A. The identity of two amino acid must change
B. The identity of one amino acid may change
C. The identity of one amino acid must change
D. The identity of one amino acid never change
Which of the following statements is true regarding introns? *…
During the termination of translation, what is the correct polypeptide sequence which will be released by the ribosome?
5' - AUG - UAU - CUC - UUU - 3' (mRNA codon sequence)
3' - UAC - AUA - GAG - AAA - 5' (tRNA anticodon sequence)
A.START - Tyr - Leu - Phe
B. Tyr - Ile - Glu - Lys
C. START - Ile - Glu - Lys
D. Ser - Tyr - Gly - Cys
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? *
A. Asparagine- Histidine
B. Lysine -Serine
C. Aspartic Acid - Histidine
D. Lysine-Glysine
Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? *
A. Deletion-Frameshift
B. Insertion- frameshift
C. Substitution-Deletion
D. Substitution-Insertion
Which of the following types of RNA is involved in the transcription phase of protein synthesis? *
A. rRNA
B. tRNA
C. hnRNA
D. no correct response
A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? *
A. 5' AAG 3
B. 5' CUU 3'
C. 3' GAA 5'…
Chapter 15 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 15.1 - Prob. 1SBCh. 15.1 - If the codon were five bases long, how many...Ch. 15.2 - For the DNA template below, what would be the...Ch. 15.2 - Prob. 2SBCh. 15.3 - Prob. 1SBCh. 15.3 - Prob. 2SBCh. 15.4 - Prob. 1SBCh. 15.4 - Distinguish between the P, A, and E sites of the...Ch. 15.4 - Prob. 3SBCh. 15.5 - How does a missense mutation differ from a silent...
Ch. 15.5 - Prob. 2SBCh. 15.5 - Prob. 3SBCh. 15.5 - Prob. 4SBCh. 15 - Eukaryotic mRNA: usessnRNPs to cut out introns and...Ch. 15 - A segment of a strand of DNA has a base sequence...Ch. 15 - Prob. 3TYKCh. 15 - Prob. 4TYKCh. 15 - Which of the following statements is false? a. GTP...Ch. 15 - Prob. 6TYKCh. 15 - Prob. 7TYKCh. 15 - Prob. 8TYKCh. 15 - Prob. 9TYKCh. 15 - A part of an mRNA molecule with the sequence 5-UGC...Ch. 15 - Discuss Concepts A mutation occurs that alters an...Ch. 15 - Discuss Concepts The normal form of a gene...Ch. 15 - Prob. 13TYKCh. 15 - Prob. 14TYKCh. 15 - Prob. 15TYKCh. 15 - Prob. 16TYKCh. 15 - Prob. 17TYKCh. 15 - Prob. 1ITD
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardGiven the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardThe following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-arrow_forward
- Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingarrow_forwardA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forwardEukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.arrow_forward
- Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forwardput in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2. Binding of large ribosomal subunit to mRNA 3. Binding of small ribosomal subunit to mRNA 4. Binding of tRNA with 2nd amino acid to the A site 5. Formation of covalent bond between methionine and second amino acid A) 1, 2, 3, 4, 5 B) 3, 1, 2, 4, 5 C) 1, 3, 2, 4, 5 D) 2, 3, 1, 4, 5 E) 3, 2, 1, 4, 5arrow_forwardFollowing is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the tRNAs that will be used for translating this mRNA segment? Group of answer choices a. CGA, AAA, GUU, and UUU b. ARG, LYS, VAL, and PHE c. GCU, UUU, CAA, and AAA d. Arg-Lys-Val-Phe e. GCT, TTT, CAA, and AAAarrow_forward
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardThe following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-Carrow_forwardThe coding strand has the following sequence. Please answer thequestions below with regard to this coding strand.5' - A T G C C T T A C G C C C C T G G A G A C G A A A A G A A G G G T G C T A TT A C G T A T T T G A A G A A G G C C A C C T C T G A G T A A – 3'(a) What is the mRNA transcribed from this DNA sequence? What is the amino acid sequenceof the protein translated from this mRNA?(b) For some reasons, an amino acid sequence of Ala-Pro-Arg-Asp was found in the protein.Please explain how this sequence appears up in the final product.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY