Translate the following amino acid sequence into one-letter code: Glu-Leu-Val-Ile-Ser-IleSer-Leu-IleVal-Ile-Asn-Gly-Ile-Asn-Leu-Ala-SerValGlu-Gly-Ala-Ser

Q: Which amino acid residue's backbone forms a hydrogen bond with the backbone of the fifth (5th)…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: Write down the amino acid sequence of the tripeptide shown below. CH3 H H₂N NH -NH,

A: The above given figure is of a tripeptide. Since we know that an amino acid sequence begins with…

Q: What is the predominant form of the following amino acids at pH= 11? What is the overall charge on…

A: Glutamic (Glu) acid is the acidic amino acid, which is charged amino acid and is present in the…

Q: Which amino acid is the least hydrophobic?

A: Note: You have posted multiple questions. So, we will solve the first one for you. If you want any…

Q: Amino sequence:…

A: There are 37 amino acid residues are present in the polypeptide chain, which consists of several…

Q: Draw the structural formulas of the following peptides, andshow which bond would be cleaved by…

A: Peptides are the short chain of amino acids that are formed by the joining of amino acids through…

Q: Give the exact location of aminon.

A: Amnion is a type of membrane that surrounds the embryo and works as a shock absorbent to protect the…

Q: What is the name of this tripeptide, using the three-letter amino acid abbreviations? Capitalize the…

A: Peptide or protein sequence is a linear chain of amino acids. There are 20 main different types of…

Q: Reveal the secret message by writing the amino acid sequence into one-letter code: Leu-…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: After the polypeptide shown below was treated with maleic anhydride, it was hydrolyzed by trypsin.…

A: The following polypeptide is considered:…

Q: H,Ñ-CH-C–NH-CH-C-NH-CH-C-0 CH, CH-CH; СНОН CH, ČH; ČH;

A: The given peptide is composed of three amino acids; it can also be called tripeptide. The sequence…

Q: All of the following are basic amino acids, except_ A. Histidine B. Arginine C. Lysine D. Glycine

A: Amino acids can be divided into basic amino acids and acidic amino acids.

Q: Define amino end

A: A polypeptide chain has directionality in the amino acids' arrangement, indicating that it has two…

Q: Use circles to represent amino acids in the polypeptide shown below. Color each amino acid using the…

A: Amino acids are organic molecules which act as building blocks of proteins. General structure of an…

Q: Write the name of the oligopeptide L-E-T-S-P-R-A-Y using their full amino acid names. Draw the…

A: Amino acids are molecules that serve as monomers for proteins. Each amino acid is composed of a…

Q: A sample of a peptide of unknown sequencewas treated with trypsin; another sample of the same…

A: Introduction: The chain of amino acids is known as a peptide which is connected by an amine or…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…

Q: Identify the nonpolar amino acids and the acidic aminoacids in the following…

A: Amino acids are the biomolecules that are composed of the carboxyl group, amino group, and R group…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H,N-C-COOH CH2…

A: Amino acids are the building blocks of proteins. The building blocks of living organisms are amino…

Q: Modify the amino acid by adding or removing atoms or bonds and by adding charges where appropriate.…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Illustrate the pathways to synthesize the following aminoacids:a. glutamineb. serinec. arginined.…

A: Introduction: The macromolecules that contain two functional groups that are amine and carboxyl are…

Q: Classify these amino acids as acidic, basic, neutral polar, or neutral nonpolar. Glutaminc Acid,…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: Draw the structure of Phe-Ser-Met-Glu, and indicate where the peptide bonds are.

A: Protein is an organic nitrogenous macromolecule that is required for human health. In the human…

Q: Which of the following amino acids is not part of tetramer that is bounded to NAM and glycine? O…

A: The bacterial cell is bounded by a chemically complex cell wall. It protects bacterial cells from…

Q: Which of the following amino acids is not part of tetramer that is bounded to NAM and glycine?…

A: Peptidoglycan is the major component of bacterial cell wall. Gram positive bacteria have a thick…

Q: Which of the following is the C-terminal amino acid in the polypeptide…

A: In a polypeptide chain, the amino acid consist of an amino group on the alpha carbon atom at one end…

Q: How many peptide bonds in this peptide chain LEU-ILE-LEU?

A: A peptide bond is an amide kind of covalent chemical connection that connects two successive…

Q: In each of the following two groups of amino acids, which amino acid would be the easiest to…

A: Titration is the process in which a known concentration of a base is added to a known concentration…

Q: Which amino acids would be expected to produce a similar sickling effect if substituted for Val at…

A: The blood disease Sickle-cell anemia occurs due to a substitution mutation. The mutated form of…

Q: What is the 1-letter code for the amino acid glutamine?     N     E     Q     G

A: GLUTAMINE l-α-amino acid Formula:- C5H10N2O3. Charge:- neutral (polar amino acid). Function:-…

Q: In each of the following pairs of amino acids, identify which amino acid would be more soluble in…

A: “Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: Select the amino acid sequence that would most likely be located in the interior of a water soluble…

A: Peptides are composed of a linear chain of amino acid sequences attached to each other via peptide…

Q: The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to…

A: There are few agents that can digest the polypeptide chain.

Q: 61. The correct name of the peptide below is -CH-C- -CH-C- -CH N-ÇH -CH-COH H2N- ČH3 CH-CH3 CH2 CH3…

A: Introduction: The correct choice is option C).

Q: Write the chemical structure of peptide containing the following amino acid PRO-SER-GLY-LEU

A: Proteins are one of the most important compounds in the cells. Proteins are involved in all cell…

Q: Identify the amino acids contained in the following tripeptide. он он НN—CH—C—N—CH—С—N—CH—CO0" CH2…

A: A peptide bond is formed between two amino acids by a covalent linkage when a carboxyl group of one…

Q: HN H H H H H Se он

A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: The melanocyte-stimulating hormone a-melanotropin has the following sequence:…

A: Aminoacids are the building blocks of proteins that are linked by peptide bond. The sequence of…

Q: H H H N, N, H H -NH2 NH H,N NH,

A: A peptide bond is an amide type of covalent chemical bond linking two consecutive alpha-amino acids…

Q: с" CH2 CH2 "НaN H с. CH С" CH Нзс CHз ZI о-о

A: The second amino acid in the given dipeptide is glutamate. It contains a negatively charged side…

Q: Consider the following protein sequence as an α helix:…

A: The sequence and identity of amino acids of a polypeptide chain make its primary structure.

Q: The primary structure of b-endorphin, a peptide containing 31 amino acids synthesized by the body to…

A: Trypsin is a serine protease that is present in the digestive system of vertebrates. It is an…

Q: How many carbon atoms are present in the R group in each of the following standard amino acids? 3-10…

A: The amino acid is the smaller subunit of proteins. They together form polypeptide chains to form a…

Q: Which one of the following sequences of five amino acids would most likely be located in the…

A: Amino acids are found to be the monomers that build the peptides and proteins. An amino acid…

Q: In this peptide the amino terminus is the amino Cys-Ala-Gly-Arg-Gln-Met acid a.arg b.Cys

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: What is the net charge at pH 7 on a peptide with the following sequence? -1…

A: In biochemistry, pH can be referred as the decimal logarithmic value of the reciprocal of H+  ions…

Q: I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R Circle the hydrophobic residues in the amino acid sequence above…

A: Amino acids are classified into 20 different types based on their physicochemical properties. They…

Q: What is the predominant form of the following amino acids at pH= 11? What is the overall charge on…

A: The compounds that have both the amine group and the carboxylic group are called amino acids. In…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.