с" CH2 CH2 "НaN H с. CH С" CH Нзс CHз ZI о-о If you were to replace the second amino acid residue with a similar amino acid in order to maintain function, which one would be best suited? Give the 3-letter abbreviation.

Q: Draw the zwitterion for the amino acid backbone of: glycine alanine proline

A: Amino acids are the subunits for the synthesis of proteins. They are formed of a carboxylic acid…

Q: Why is it no longer considered necessary to determine the Nterminal amino acid of a protein as a…

A: N-terminal amino acid : The N-terminal is the start of a protein or polypeptide referring to the…

Q: Amino Acid: Asn-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Lys    What is the one letter code of this amino acid…

A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are the building…

Q: Which of the following amino acid changes can result from a single base-pair substitution? Explain…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: what is the amino acid of 5’ U A G G C U A C U A C C A  G G U A U C G G U C U G A U C U A G C U A G…

A: Proteins are synthesized from mRNA through translation process. In the translation process, the mRNA…

Q: All L amino acids have an S absolute configuration except L - cysteine, which has the R…

A: All amino acids except glycine are chiral. All naturally occurring amino acids are L-amino acids.…

Q: Identify the nucleotide. CH HN 9. N' O. 0-P-OCH2 O DUMP O dGMP O DAMP O dCMP O dTMP

A: Given below is a structure of nucleotide as it contains a base, sugar & phosphate group. The…

Q: Given the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in…

A: Biuret test is a test used for detecting the presence of peptide bonds. Biuret Reagent is  formed by…

Q: Please clearly identify each numbered amino acid side chain, below. Your description should include…

A: amino acids are the building blocks of proteins . they have amino group , acid group and variable R…

Q: The peptide below NH-CH- HẠN CH- ČH, -NH-CH- NH-CH- NH-CH- OH CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH HO-CH,…

A: Amino acids are the building blocks of peptides. The net charge on a peptide depends on the sequence…

Q: Write the name of the oligopeptide L-E-T-S-P-R-A-Y using their full amino acid names. Draw the…

A: Amino acids are molecules that serve as monomers for proteins. Each amino acid is composed of a…

Q: fof NH HO-P-O-P-O-F `NH2 ÓH ÓH OH OH OH Which nucleotide is shown in the picture above?

A: A nucleotide is a molecule that is organic, containing a nucleoside and a phosphate. It is the basic…

Q: Identify the following amino acid at pH = 7 (aqueous form): (COO-)–CH(NH3+)–CH2–(COO-) aspartic…

A: Amino acids are the monomers that build up the protein. They are termed as amino acids because they…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H,N-C-COOH CH2…

A: Amino acids are the building blocks of proteins. The building blocks of living organisms are amino…

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: Give the amino acid sequence of an octapeptide that contains the amino acids Tyr, Ala, Leu (2…

A: Introduction: There are 20 known amino acids at present. These are biomolecules that form proteins…

Q: what are 20 different amino acid names explain each of them and explain their 3 letter dimention,1…

A: Biochemistry is a branch of biology that mostly deals with the structure, function, and interaction…

Q: Define ε-amino group

A: The amino group is the -NH2  substituent in a carboxyl group. Amino groups are components of amino…

Q: Identify and match the lettered regions in the titration curve of a basic amino acid. pic 5.jpg…

A: Histidine is an amino acid that has an imidazole ring as the functional group (R group). Thus, the…

Q: Calculate the overall net charge of the following polypeptide at pH = 2.0…

A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers…

Q: Draw the structure of Phe-Ser-Met-Glu, and indicate where the peptide bonds are.

A: Protein is an organic nitrogenous macromolecule that is required for human health. In the human…

Q: The sequence of a peptide is given below. Ala-gly-val-leu-trp-lys-ser-phe-arg-proWhich peptide…

A: Chymotrypsin belongs to a group of enzymes that all use a serine as an active site to cleave peptide…

Q: HO, NH2 HO This amino acid is called It's three-letter abbreviation is and its one-letter…

A: Proteins are the building blocks, made up of amino acids. They are of twenty different types that…

Q: HO NH2 H. ZI

A: Amino acids are organic compounds that consist of an alpha-amino group, a carboxy group, and an R…

Q: Treatment of a polypeptide with 2-mercaptoethanol yields two polypeptides  1.…

A: Given that treatment of a polypeptide with 2 marcaptoethanol yielded 2 polypeptides: 1.…

Q: Draw a tripeptide gly-phe-ala

A:

Q: Draw peptide Pro-Ser-Ala-Phe-Glu as you would see it at pH 7. Include stereochemistry.

A: Proteins are made of different amino acids joined through peptide bonds. The amino acids are…

Q: Ala-Phe-Pro-Cys-Clu-Arg-Arg-Pro-His-Gly-Lys-Clu Calculate the net charge on the polypeptide at a.…

A: Note: There is no amino acid with a three-letter code as Clu. The charge calculation will be carried…

Q: Ile-Ala-His-Thr-Tyr-Gly-Pro-Phe-Glu-Ala-Ala-Met-Cys-Lys-Trp-Glu-Ala-Gln-Pro-Asp-Gly-Met-Glu-Cys-Ala-…

A: Most common secondary are the α-helix and the β-pleated sheet. Both the secondary structure is…

Q: Identify the a-carbon of aminolevulinic acid.

A: Carbon atoms are named from one end of an organic compound. The carbon atom with the  substituent…

Q: Identify the amino acid. OH 0=C H2 CH-C H2 -CNH2 NH2

A: Amino acids are the monomers that build polymers called proteins. The amino acids are linked…

Q: What is the 1-letter code for the amino acid glutamine?     N     E     Q     G

A: GLUTAMINE l-α-amino acid Formula:- C5H10N2O3. Charge:- neutral (polar amino acid). Function:-…

Q: A B Amino Acid Lysine Abbreviation 3- Letters Lys 1- Letter K pk₁ -COOH 2.18 pK₂ -NHS* 8.95 PKR R…

A: Amino acids are biomolecules where an alpha carbon is bonded to an amine group , a carboxylic group,…

Q: What is the net charge at pH 7 on a peptide with the following sequence?…

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: 61. The correct name of the peptide below is -CH-C- -CH-C- -CH N-ÇH -CH-COH H2N- ČH3 CH-CH3 CH2 CH3…

A: Introduction: The correct choice is option C).

Q: The full name of this amino acid is The 3-letter abbreviation is Please also note the following: •…

A: Amino acids are biomolecules composed of a central carbon bonded to 4 groups. 3 out of these 4…

Q: HN H H H H H Se он

A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…

Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…

A: Answer :-                             Met-ala-phe-lys-stop                  DNA…

Q: From the sequence D-I-LI-G-A-F, how many amino acids are aromatic?

A: Amino acids : There are hundreds of amino acids present in the living organisms. Amino acids are…

Q: Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln

A: All the amino acids mentioned in the question are linked Together by peptide bonds that is CONH. A…

Q: Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence:…

A: Closer the DNA constitution of organisms closer are they in their protein content. One can determine…

Q: Suggest which part of this sequence belongs to the inner part of the protein and which to the outer…

A: Proteins are polypeptides formed of monomeric units-amino acids. There are 20 different amino acids…

Q: Translate the following amino acid sequence into one-letter code:…

A: The unique one-letter code was developed for easy and fast recognition of amino acids. Each of the…

Q: Assign IUPAC names to each of the following small peptides.Gly-Ala-Leu…

A: The international union of pure and applied chemistry (IUPAC) name of a peptide refers to the full…

Q: Identify each amino shown in Fischer projection. Indicate whether the d- or l-enantiomer is shown

A: The amino acid is the smallest subunit of the protein, which helps in the synthesis of peptides.

Q: Does amino acid sequence or amino acid composition have more of an impacts the protien structure?

A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serve as monomers…

Q: Spell out the name of the polypeptide using three letter codes for each amino acid separated with…

A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…