True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs
Q: Why the concept of a DNA library is still important for a number of modern applications ?
A: A DNA library can be described as the collection of DNA fragments that are kept and propagated in a ...
Q: How does temperature influence the manufacture of substances, their reuse for respiration, and have ...
A: Plants utilize the process of photosynthesis to manufacture substances, generally food. During this ...
Q: Describe the method of preparation of planting material for Ginger and describe how it can be propag...
A: Introduction Ginger (Zingiber officinale) is a plant native to Asia, it is a flowering plant whose r...
Q: Explain the Molecular Techniques for Analyzing DNA ?
A: DNA is a double helical structure that is present in the nucleus of the cell. This DNA contains the ...
Q: In which specific area in the leaf does the dark reaction occur? In what area do the light reactions...
A: Light reaction is the process of photosynthesis in which the sunlight energy is converted to ATP and...
Q: Name the two (2) different varieties of Ginger and describe two (2) characteristics of each
A: * Zingiber officinale belongs to Zingiberaceae family is known as ginger. *Ginger a flowering plan...
Q: How to calculate the percentage of phage that was filtered using a 0.45 um filter? PFU rep 1- 121 P...
A: Bacteria growing on MF-Millipore filters (thickness, 150 micro m) passed through the underlying memb...
Q: Use the figure showing the glaciological year to outline how increasing average temperatures impact ...
A: Pressure melting point is defined as the temperature at which ice begins to melt under a given amoun...
Q: Explain America’s “class” bias in which the amount of money a middle class makes affects how they ar...
A: While an income-based definition of middle-class relies on the money coming into a household from a ...
Q: Analyze the graph and identify some factors that may contribute to the rotifer population leveling o...
A: Rotifers are widely distributed and can be seen in the sea and fresh waterways all over the world.
Q: In February the WHO reported several cases of farm workers being infected with the bird flu influenz...
A: H5N8 - The H stands for one of the 16 different hemagglutinin proteins contained in a virus that all...
Q: Q1: Why are E.coli cells subjected to heat shock induction when the optical density of the bacterial...
A: 1. The heat shock response is induced as a consequence of a rapid increase in sigma32 levels and sti...
Q: In Drosophila, sepia eyes (se), curled wings (cu) and ebony body (e) are found, in this order, on ch...
A: If genes are located on the same chromosome then they are known as linked genes. In this condition t...
Q: What is the difference between renewal and nonrenewable resources? How important is it in business? ...
A: The vast majority of natural resources, such as coal and petroleum, were created millions of years a...
Q: Draw a diagram illustrating a bacterial CRISPR locus. Label your drawing with a brief description of...
A: CRISPR is a family of DNA sequences that can be found in the genomic section of the prokaryotic orga...
Q: Estimate the number of hominin species that have existed in both robust and gracile clades of evolut...
A: Researchers have narrowed down on the fact that based on the number of unearthed fossils, there were...
Q: Discuss how qPCR, DNA microarrays (DNA chips), and RNA- seq analysis are used to compare levels of g...
A: The functions of a gene can be studied by looking at how it expresses in a specific cell and how it ...
Q: In the light reactions of photosynthesis, an electron is taken from causing the formation of The enz...
A: Photosynthesis is the process that produces organic molecules from simple inorganic molecules from t...
Q: a. During prophase I, the homologues come together and exchange genetic material. Now the inherited ...
A: Prophase 1 is the first stage of first meiotic division. It is a very significant phase of meiosis a...
Q: What best describes the amoebas division?
A: A single parent is involved in this Mode of asexual account, which is one of the most common types. ...
Q: explain transcriptional stages such as initiation, elongation, and termination. In this article, ple...
A:
Q: Are there ribosomes in a plant cell?
A: Yes, ribosomes are found in both plant and animal cells, and they function in the same way. Yes, you...
Q: Forests take in carbon dioxide from the air, thus it is called “carbon dioxide sinks” or “carbon sin...
A: Carbon dioxide sinks are the storage systems which hold most of carbon dioxide in our world These ...
Q: A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves with...
A: A plasmid is a small extrachromosomal DNA molecule that exists in a cell and is physically distinct ...
Q: What is Denaturation ?
A: Introduction :- Many of the weak connections, or bonds (e.g., hydrogen bonds), inside a protein mole...
Q: Question # 17 What are living and nonliving reservoirs?
A: Introduction In this question we will discuss about the living and non-living reservoirs.
Q: What best describes the amoebas division?
A:
Q: What is the advantage of the C4 photosynthetic pathway as compared to the conventional C3 pathway? H...
A: Introduction: Photosynthesis is the process of preparing food in the presence of sunlight and chloro...
Q: Consider a mutant hepatocyte cell in which the Q-cycle was not used and teh two electrons from ubiqu...
A: Electron Transport Chain Electron Transport Chain or ETC is a series of proteins that creates a pro...
Q: See attached. What effects do these problems create on the ecosystem?
A: 1. If there is improper waste disposal than it can affect the soil fertility as well as it can emit ...
Q: Why do implantable defibrillators require far less power on their own than a pacemaker?
A: Pacemaker is known as artificial heart which is incorporated of any problem in functioning of the he...
Q: The normal vaginal microbiota is usually dominated by D a variety of lactobacilli O Gardnerella O Ca...
A: Microbes are organisms that are too tiny to see without a microscope, such as bacteria, archaea, and...
Q: "Specific Genes Can Be Recovered from a Library by Screening". Describe about this ?
A: The genes can be referred to as the basic unit that can be transferred from parents to the next gene...
Q: In Figure 12-11b, in what chromosomal region are youlikely to find the most H1 histone protein?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: 3. The laboratory technician dilutes her sample serially 1:10 and plates the following dilutions: 10...
A: The technician dilutes the sample in 1:10, 1:100, 1:1000, 1:10000, 1:00000, 1:1000000 dilution seria...
Q: Describe at least one important application of DNA technology in each of the following fields: medic...
A: These days, DNA-based technology is very common. Biotechnology is the process of manipulating living...
Q: Explain the Molecular Techniques for Analyzing RNA ?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: In making red blood cell suspension, why do we need to wash red blood cells in saline?
A: Red cell suspension is a common reagent used for many serologic procedures. Red cell suspensions pro...
Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single stra...
A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule i...
Q: Differentiate the patterns of biodiversity? (Spatial pattern of biodiversity and Temporal pattern of...
A: Answer Spatial and temporal pattern of biodiversity :
Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is s...
A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the...
Q: Which of the two molecules from seventh step of glycolysis, 1,3 Bisphosphoglycerate or 3-Phosphoglyc...
A: Embden Meyerhof Pathway - Glycolysis. The sequence of reactions by which glucose is degraded anaerob...
Q: Describe some mechanisms of antibiotic action and antibioticresistance
A: Antibiotics:- The word Antibiotics consists of two words "anti" and "biotics" which means against li...
Q: QUESTION 5 Match the term to the correct description. + Blastomeres A. Small cells formed during cle...
A: Match the term to the correct description.
Q: Differentiate motor nerve ending and sensory nerve endings? Explain briefly and be direct to the poi...
A: The nerves which carry information from Central Nervous System(Brain and spinal cord) to Peripheral ...
Q: Explain the importance of thermostable polymerase used for PCR ?
A: Introduction: Biotechnology is a discipline of science concerned with the use of biological methods ...
Q: How new sequencing methodologies are replacing traditional genomic DNA libraries ?
A: The term genomic DNA library is associated with DNA fragments collection comprising an organism's wh...
Q: What are thermocyclers ?
A: Introduction Polymerase chain reaction (PCR) is a widely used method for rapidly producing millions ...
Q: Why are cellular respiration and photosynthesis thought to be cyclical reaction? Think about the pro...
A: Introduction Cellular respiration is what cells do to break up sugars to get the energy they can use...
Q: How does doing a Dichotomous key influence one's decision-making when it comes to sorting or recogni...
A: Dicotomous key is based on the characteristics of the organisms which is needed to be identified. Th...
Step by step
Solved in 2 steps
- True or False 1. There can be a quantitative determination of the degree of supercoiling in a DNA sample. 2. Topoisomerases can cut phosphodiester bonds and the DNA ligases will have to seal the nicks whenever there is a need to relieve the supercoiling. 3. Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys. 4. The supercoiled DNA can either be positively or negatively supercoiled. 5. The Sanger method of DNA sequencing follows the principle of complementarity just like in the replication process.Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
- Explain your experimental approach if you must correct the genetic defect phenylketonuria, which is caused by mutations in the phenylalanine hydroxylase gene using the CRISPR/Cas9 system and homology directed DNA repair.Please answer asap and type your answer and do not copy from anywhere please NOTE*** double stranded complementary DNA I have determined is GTCATACCTAGGGTA with a palindromic site of CCTAGG and the enzyme BamHI that will cut the recognition site. In the double-stranded DNA you have determined, there is also another recognition site for common restriction enzymes. Which enzyme would cut your DNA at this other recognition site? (Hint: Remember that one recognition site can overlap with or be completely contained by the sequence containing another recognition site.) HindIII Sau3AI AluI BamHIAmplified target regions of four different samples were separated using gel electrophoresis. DNA fragments labeled with the isotope P32 were separated by gel electrophoresis. The ultimate reason why unique target regions within each sample separate from each other in the gel is due to Amplified target regions of four different samples were separated using gel electrophoresis. DNA fragments labeled a) the amount of P32 bonded to each fragment. b) the number of restriction sites in each fragment. c) the distance between the primer recognition sites. d) the number of positive charges in each fragment.
- I get everything else in this problem other than the third option: Introduce the mutant human HD allele as a transgene into the mouse genome with transgene integration anywhere in the mouse genome. Why is the first question (left) okay with introducing mutant human HD allele and the second question (right) is not? I heard that introducing allele without using CRISPR-Cas9 is very rare and difficult. If so, how does it work in the first problem (Hungtinton's chorea)?Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.ques 1 . A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained: Enzyme Fragment size (kb). EcoRI 1.3, 1.3 Hpall 2.6 HindIII 2.6 EcoRI+Hpall 1.3, 0.8, 0.5 EcoRI + HindIII 0.6, 0.7, 1.3 a. Is the original molecule linear or circular? b. Draw a map of restriction sites, showing distances between sites, that is consistent with the data presented. ques 2. You have double-stranded DNA that you radioactively label at the 5' ends. Digestion of this molecule with either EcoRI or BamHI yields the following fragments. The numbers are in kilobases (kb) and an asterisk Indicates the fragments that are unlabled EcoRI: 2.8, 4:6, 6.2*, 7.4, 8.0* BamHI: 6.0%, 10.0", 13.0 IF unlabeled DNA is digested with both enzymes simultaneously, the fragments 1.0, 2.0, 2.8, 3.6, 6.0, 6.2,7.4. What is the restriction map for the two enzymes?
- NEED ASAP Using the list provided (note you may not need all the steps listed) state the steps in cDNA production 1. Confirm size of bands by comparing to molecular size marker. 2. Ligate oligonucleotides onto blunt ended product. 3. Cut the cDNA with a unique restriction enzyme. 4. Ligate the cDNA and vector followed by transformation of E. coli. 5. Plate cells onto LB-ampicillin plates containing X-gal. 6. Choose colonies that are white in colour. 7. Cut plasmid with unique restriction enzymes. 8. The size of the clone is small and it will ensure that the entire gene will be found in one fragment. 9. Employ replica plating technique and select cells that are ampicillin-sensitive and tetracycline resistant. 10. Blot petri plates with a nitrocellulose filter, lyse the cells and denature the DNA with a dilute sodium hydroxide solution. 11. Blot electrophoresis gel with nitrocellulose filter and denature the DNA with a dilute sodium hydroxide solution. 12. Flood the filters with…The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGa.) wanting to clone gene Z into pVector, the gene is amplified by PCR and restriction sites are added to the flanking ends. without realizing that the antibotic resistant gen )tetR) had a Sal1 site, you decide to add EcoR1 and Sal1 recofnition sequencen into the 12-nucleotide primers. Write the sequence of the 2 primers, noting the 5' and 3' ends?
